Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127580369:

Variant ID: vg1127580369 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27580369
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGCCCATTAATTGCTTTCTTTTCAGCCCTAGCTCAGACCGTAGGTTTTGACCATAATTAGATCAACGCATCTCATCCACAAATCGATTAATTTGTAGA[T/C]
GTGAATTAGATCGAGTTCGAGACGAAAGGAATCATTGAAAAACAGAAAGACTCGGAAATTTTTTTTTAATAATGGATTAAATCGGTCTCTACACCCAAAG

Reverse complement sequence

CTTTGGGTGTAGAGACCGATTTAATCCATTATTAAAAAAAAATTTCCGAGTCTTTCTGTTTTTCAATGATTCCTTTCGTCTCGAACTCGATCTAATTCAC[A/G]
TCTACAAATTAATCGATTTGTGGATGAGATGCGTTGATCTAATTATGGTCAAAACCTACGGTCTGAGCTAGGGCTGAAAAGAAAGCAATTAATGGGCTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	31.50%	1.33%	11.93%	NA
All Indica	2759	51.00%	32.10%	1.27%	15.62%	NA
All Japonica	1512	67.70%	29.70%	1.52%	1.06%	NA
Aus	269	18.60%	36.80%	1.49%	43.12%	NA
Indica I	595	67.20%	8.70%	3.36%	20.67%	NA
Indica II	465	84.70%	9.50%	0.22%	5.59%	NA
Indica III	913	22.60%	59.50%	0.44%	17.52%	NA
Indica Intermediate	786	51.90%	31.30%	1.27%	15.52%	NA
Temperate Japonica	767	86.20%	9.00%	2.87%	1.96%	NA
Tropical Japonica	504	39.50%	60.10%	0.20%	0.20%	NA
Japonica Intermediate	241	68.00%	32.00%	0.00%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	66.70%	31.10%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127580369	T -> DEL	N	N	silent_mutation	Average:10.939; most accessible tissue: Callus, score: 42.231	N	N	N	N
vg1127580369	T -> C	LOC_Os11g45550.1	upstream_gene_variant ; 4341.0bp to feature; MODIFIER	silent_mutation	Average:10.939; most accessible tissue: Callus, score: 42.231	N	N	N	N
vg1127580369	T -> C	LOC_Os11g45560.1	upstream_gene_variant ; 1087.0bp to feature; MODIFIER	silent_mutation	Average:10.939; most accessible tissue: Callus, score: 42.231	N	N	N	N
vg1127580369	T -> C	LOC_Os11g45570.1	downstream_gene_variant ; 1849.0bp to feature; MODIFIER	silent_mutation	Average:10.939; most accessible tissue: Callus, score: 42.231	N	N	N	N
vg1127580369	T -> C	LOC_Os11g45580.1	downstream_gene_variant ; 3254.0bp to feature; MODIFIER	silent_mutation	Average:10.939; most accessible tissue: Callus, score: 42.231	N	N	N	N
vg1127580369	T -> C	LOC_Os11g45560-LOC_Os11g45570	intergenic_region ; MODIFIER	silent_mutation	Average:10.939; most accessible tissue: Callus, score: 42.231	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127580369	1.70E-07	NA	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127580369	1.75E-07	1.40E-14	mr1133	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127580369	8.69E-06	6.99E-08	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127580369	6.71E-07	1.81E-12	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127580369	NA	3.37E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127580369	NA	2.73E-07	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251