Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127497936:

Variant ID: vg1127497936 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 27497936
Reference Allele: G	Alternative Allele: C,GTGGAGC
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGAGGAGGGGGTGGTCGCCGAGGCGGGAGAAGCCGGCGCGCGGGAACTCCGCGACGGCCGGGTGCGGGTGGTCGGCGAGGAGGGCGAGAGTAGATGGAG[G/C,GTGGAGC]
GCATTGTTGCGTGGAGGCGGTAGTGGTTACGCGGCAGGAGGAGGAAGTGGTGGCGAGGAGGAGGCGTGGCGGCGGCCGGTGGATGCGACGGCGGTGGATG

Reverse complement sequence

CATCCACCGCCGTCGCATCCACCGGCCGCCGCCACGCCTCCTCCTCGCCACCACTTCCTCCTCCTGCCGCGTAACCACTACCGCCTCCACGCAACAATGC[C/G,GCTCCAC]
CTCCATCTACTCTCGCCCTCCTCGCCGACCACCCGCACCCGGCCGTCGCGGAGTTCCCGCGCGCCGGCTTCTCCCGCCTCGGCGACCACCCCCTCCTCGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.30%	40.50%	0.36%	0.00%	GTGGAGC: 11.85%
All Indica	2759	35.70%	48.50%	0.40%	0.00%	GTGGAGC: 15.40%
All Japonica	1512	69.90%	29.80%	0.20%	0.00%	GTGGAGC: 0.13%
Aus	269	42.80%	8.60%	0.00%	0.00%	GTGGAGC: 48.70%
Indica I	595	29.10%	45.20%	0.50%	0.00%	GTGGAGC: 25.21%
Indica II	465	24.10%	73.50%	0.43%	0.00%	GTGGAGC: 1.94%
Indica III	913	44.80%	40.00%	0.55%	0.00%	GTGGAGC: 14.68%
Indica Intermediate	786	36.90%	46.20%	0.13%	0.00%	GTGGAGC: 16.79%
Temperate Japonica	767	79.40%	20.50%	0.13%	0.00%	NA
Tropical Japonica	504	58.90%	40.70%	0.00%	0.00%	GTGGAGC: 0.40%
Japonica Intermediate	241	62.70%	36.50%	0.83%	0.00%	NA
VI/Aromatic	96	30.20%	67.70%	1.04%	0.00%	GTGGAGC: 1.04%
Intermediate	90	56.70%	40.00%	2.22%	0.00%	GTGGAGC: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127497936	G -> GTGGAGC	LOC_Os11g45410.1	upstream_gene_variant ; 235.0bp to feature; MODIFIER	silent_mutation	Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511	N	N	N	N
vg1127497936	G -> GTGGAGC	LOC_Os11g45420.1	upstream_gene_variant ; 888.0bp to feature; MODIFIER	silent_mutation	Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511	N	N	N	N
vg1127497936	G -> GTGGAGC	LOC_Os11g45410-LOC_Os11g45420	intergenic_region ; MODIFIER	silent_mutation	Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511	N	N	N	N
vg1127497936	G -> C	LOC_Os11g45410.1	upstream_gene_variant ; 234.0bp to feature; MODIFIER	silent_mutation	Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511	N	N	N	N
vg1127497936	G -> C	LOC_Os11g45420.1	upstream_gene_variant ; 889.0bp to feature; MODIFIER	silent_mutation	Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511	N	N	N	N
vg1127497936	G -> C	LOC_Os11g45410-LOC_Os11g45420	intergenic_region ; MODIFIER	silent_mutation	Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1127497936	G	C	-0.01	-0.02	-0.04	-0.02	-0.03	-0.03
vg1127497936	G	GTGGA*	-0.04	-0.03	0.05	0.01	0.02	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127497936	4.10E-06	8.24E-10	mr1299	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936	NA	2.12E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936	NA	4.61E-06	mr1440	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936	NA	4.53E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936	NA	5.63E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936	NA	1.79E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936	NA	2.65E-07	mr1872	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936	1.09E-06	NA	mr1924	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936	NA	5.06E-06	mr1924	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936	NA	4.98E-06	mr1976	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251