Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127413986:

Variant ID: vg1127413986 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27413986
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGATCTGGACATGATCTTATATGATTAAAATATGGGCAAATAGCACAGAAGCATTTGGTGCATCTTTGTTGTGGCACATGAGGCATTGCATTATTTGTA[G/A]
TAGCACTTTCAAGGTTTCAATTTTTAGGGGTAACTACACCATTAAAACCCTAGATTTGTGATATTTTAAGGCGTTTTATGCCACGAATTTGTAGATCTGA

Reverse complement sequence

TCAGATCTACAAATTCGTGGCATAAAACGCCTTAAAATATCACAAATCTAGGGTTTTAATGGTGTAGTTACCCCTAAAAATTGAAACCTTGAAAGTGCTA[C/T]
TACAAATAATGCAATGCCTCATGTGCCACAACAAAGATGCACCAAATGCTTCTGTGCTATTTGCCCATATTTTAATCATATAAGATCATGTCCAGATCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.30% 3.00% 0.38% 0.32% NA
All Indica  2759 99.80% 0.00% 0.18% 0.00% NA
All Japonica  1512 89.40% 8.70% 0.86% 0.99% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.00% 0.64% 0.00% NA
Temperate Japonica  767 84.40% 14.30% 1.17% 0.13% NA
Tropical Japonica  504 98.60% 0.80% 0.00% 0.60% NA
Japonica Intermediate  241 86.30% 7.50% 1.66% 4.56% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127413986 G -> A LOC_Os11g45320.1 upstream_gene_variant ; 2753.0bp to feature; MODIFIER silent_mutation Average:49.74; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1127413986 G -> A LOC_Os11g45290.1 downstream_gene_variant ; 4051.0bp to feature; MODIFIER silent_mutation Average:49.74; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1127413986 G -> A LOC_Os11g45290.2 downstream_gene_variant ; 3993.0bp to feature; MODIFIER silent_mutation Average:49.74; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1127413986 G -> A LOC_Os11g45295.1 intron_variant ; MODIFIER silent_mutation Average:49.74; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg1127413986 G -> DEL N N silent_mutation Average:49.74; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127413986 G A -0.03 -0.01 -0.01 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127413986 6.37E-12 6.37E-12 mr1191_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251