Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127382510:

Variant ID: vg1127382510 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27382510
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.04, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

TGAGAGCAGTTATGACGCACCTGCAACCTAAAAAGGTCTCGTCCAGAAAAATTATTTATGCAGCAATGAAAGTTGATTTTAGTACATCGAGTTATTTACT[A/T]
CTTATTATTTCTTTATAAATGTGTATCACATCTACAAATAAATTTTGGATATGCAGCACGGTGCATATCCAAATCTCTACTATTATAAAAATTGAAGATG

Reverse complement sequence

CATCTTCAATTTTTATAATAGTAGAGATTTGGATATGCACCGTGCTGCATATCCAAAATTTATTTGTAGATGTGATACACATTTATAAAGAAATAATAAG[T/A]
AGTAAATAACTCGATGTACTAAAATCAACTTTCATTGCTGCATAAATAATTTTTCTGGACGAGACCTTTTTAGGTTGCAGGTGCGTCATAACTGCTCTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	21.60%	0.13%	0.00%	NA
All Indica	2759	73.50%	26.30%	0.18%	0.00%	NA
All Japonica	1512	81.80%	18.10%	0.07%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	64.00%	35.80%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	59.80%	40.20%	0.00%	0.00%	NA
Indica Intermediate	786	81.90%	17.60%	0.51%	0.00%	NA
Temperate Japonica	767	67.40%	32.50%	0.13%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	91.70%	8.30%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127382510	A -> T	LOC_Os11g45240.1	upstream_gene_variant ; 771.0bp to feature; MODIFIER	silent_mutation	Average:49.267; most accessible tissue: Callus, score: 70.328	N	N	N	N
vg1127382510	A -> T	LOC_Os11g45250.1	downstream_gene_variant ; 1006.0bp to feature; MODIFIER	silent_mutation	Average:49.267; most accessible tissue: Callus, score: 70.328	N	N	N	N
vg1127382510	A -> T	LOC_Os11g45250.2	downstream_gene_variant ; 1006.0bp to feature; MODIFIER	silent_mutation	Average:49.267; most accessible tissue: Callus, score: 70.328	N	N	N	N
vg1127382510	A -> T	LOC_Os11g45240-LOC_Os11g45250	intergenic_region ; MODIFIER	silent_mutation	Average:49.267; most accessible tissue: Callus, score: 70.328	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127382510	NA	5.67E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510	NA	1.50E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510	NA	3.89E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510	NA	5.74E-06	mr1208_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510	NA	1.32E-07	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510	NA	5.02E-06	mr1406_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510	3.50E-06	3.50E-06	mr1424_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510	NA	6.40E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510	4.78E-06	4.78E-06	mr1884_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510	NA	6.54E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251