Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127227168:

Variant ID: vg1127227168 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27227168
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCAAGTTAATAATTTTATGCTTAAGACCGATTCCCCCGCGTCGCTCTCGTGCGGGCGGCTCGGGGGGCGAAAAAACCCTAGCCGCCAGCGCCTCCACT[T/C]
CCTCTCCGTTGCCTCGCCGGAGTCGGAGCTTGCCGGCGGCAAGCCGGCAGCAAGCACGGAAGGCGGCGGCGAGGCTCTCCCTCTTCTTGGCGTATCCCAC

Reverse complement sequence

GTGGGATACGCCAAGAAGAGGGAGAGCCTCGCCGCCGCCTTCCGTGCTTGCTGCCGGCTTGCCGCCGGCAAGCTCCGACTCCGGCGAGGCAACGGAGAGG[A/G]
AGTGGAGGCGCTGGCGGCTAGGGTTTTTTCGCCCCCCGAGCCGCCCGCACGAGAGCGACGCGGGGGAATCGGTCTTAAGCATAAAATTATTAACTTGCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 11.60% 2.90% 31.49% NA
All Indica  2759 56.70% 12.80% 1.56% 28.96% NA
All Japonica  1512 55.00% 3.60% 5.75% 35.71% NA
Aus  269 28.30% 28.30% 1.12% 42.38% NA
Indica I  595 71.40% 11.30% 0.67% 16.64% NA
Indica II  465 35.30% 11.20% 0.43% 53.12% NA
Indica III  913 64.30% 11.70% 2.52% 21.47% NA
Indica Intermediate  786 49.20% 16.30% 1.78% 32.70% NA
Temperate Japonica  767 53.20% 4.80% 10.43% 31.55% NA
Tropical Japonica  504 52.40% 2.60% 0.79% 44.25% NA
Japonica Intermediate  241 66.00% 1.70% 1.24% 31.12% NA
VI/Aromatic  96 28.10% 57.30% 3.12% 11.46% NA
Intermediate  90 62.20% 10.00% 1.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127227168 T -> DEL N N silent_mutation Average:58.613; most accessible tissue: Minghui63 flag leaf, score: 97.744 N N N N
vg1127227168 T -> C LOC_Os11g44960.1 downstream_gene_variant ; 1081.0bp to feature; MODIFIER silent_mutation Average:58.613; most accessible tissue: Minghui63 flag leaf, score: 97.744 N N N N
vg1127227168 T -> C LOC_Os11g44960-LOC_Os11g44970 intergenic_region ; MODIFIER silent_mutation Average:58.613; most accessible tissue: Minghui63 flag leaf, score: 97.744 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127227168 T C 0.01 0.01 0.01 0.02 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127227168 3.13E-06 9.10E-06 mr1517 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251