Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127186610:

Variant ID: vg1127186610 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27186610
Reference Allele: C	Alternative Allele: T,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.08, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AACGTTTGATGTGACGGGGCAAAAAAAATTGCCGGTGGATCTAAACACCCCCTAACTTGTAAAGATTAAATTTTATTTGAAATAAACCAACTTTTATCCT[C/T,G]
TTGCTTACCATCGGTCCATAAATCATGAATTTTATTCACTCAATATCTCTCAACTACTCCCTCCATCCGAAAACAAATTAATATTGTATGAATCTGGGAT

Reverse complement sequence

ATCCCAGATTCATACAATATTAATTTGTTTTCGGATGGAGGGAGTAGTTGAGAGATATTGAGTGAATAAAATTCATGATTTATGGACCGATGGTAAGCAA[G/A,C]
AGGATAAAAGTTGGTTTATTTCAAATAAAATTTAATCTTTACAAGTTAGGGGGTGTTTAGATCCACCGGCAATTTTTTTTGCCCCGTCACATCAAACGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.80%	15.00%	0.17%	0.00%	G: 0.02%
All Indica	2759	80.20%	19.60%	0.14%	0.00%	G: 0.04%
All Japonica	1512	91.40%	8.50%	0.13%	0.00%	NA
Aus	269	88.50%	11.20%	0.37%	0.00%	NA
Indica I	595	94.60%	5.40%	0.00%	0.00%	NA
Indica II	465	93.80%	6.00%	0.00%	0.00%	G: 0.22%
Indica III	913	64.20%	35.60%	0.22%	0.00%	NA
Indica Intermediate	786	79.80%	20.00%	0.25%	0.00%	NA
Temperate Japonica	767	93.10%	6.80%	0.13%	0.00%	NA
Tropical Japonica	504	88.70%	11.10%	0.20%	0.00%	NA
Japonica Intermediate	241	91.70%	8.30%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127186610	C -> T	LOC_Os11g44910.1	upstream_gene_variant ; 2551.0bp to feature; MODIFIER	silent_mutation	Average:27.727; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1127186610	C -> T	LOC_Os11g44920.1	upstream_gene_variant ; 4401.0bp to feature; MODIFIER	silent_mutation	Average:27.727; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1127186610	C -> T	LOC_Os11g44910.2	upstream_gene_variant ; 2562.0bp to feature; MODIFIER	silent_mutation	Average:27.727; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1127186610	C -> T	LOC_Os11g44910.3	upstream_gene_variant ; 2562.0bp to feature; MODIFIER	silent_mutation	Average:27.727; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1127186610	C -> T	LOC_Os11g44910-LOC_Os11g44920	intergenic_region ; MODIFIER	silent_mutation	Average:27.727; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1127186610	C -> G	LOC_Os11g44910.1	upstream_gene_variant ; 2551.0bp to feature; MODIFIER	silent_mutation	Average:27.727; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1127186610	C -> G	LOC_Os11g44920.1	upstream_gene_variant ; 4401.0bp to feature; MODIFIER	silent_mutation	Average:27.727; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1127186610	C -> G	LOC_Os11g44910.2	upstream_gene_variant ; 2562.0bp to feature; MODIFIER	silent_mutation	Average:27.727; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1127186610	C -> G	LOC_Os11g44910.3	upstream_gene_variant ; 2562.0bp to feature; MODIFIER	silent_mutation	Average:27.727; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg1127186610	C -> G	LOC_Os11g44910-LOC_Os11g44920	intergenic_region ; MODIFIER	silent_mutation	Average:27.727; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127186610	2.45E-07	NA	mr1133_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127186610	3.12E-06	1.01E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127186610	7.44E-07	NA	mr1667_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127186610	NA	3.80E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127186610	7.12E-06	NA	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127186610	8.31E-06	5.32E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251