Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126943355:

Variant ID: vg1126943355 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26943355
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGATTGAGAGCAGGCAGCTGCTGGCTGAAAGGTGAGAAAGCAGTGAAGCTATGGCACATTTACAGTGGGAAGGCATGGATCGAATGGCTACTATTGC[G/A,T]
CAGCTGACAGGAGTGGACGCTCTGGGGCTCATCTCAACGATCGTGCAGGCGGCGCAGGCAGTTTGCCGGAACAAGGAGACCTGCCAGGAGCTGGTGCAGG

Reverse complement sequence

CCTGCACCAGCTCCTGGCAGGTCTCCTTGTTCCGGCAAACTGCCTGCGCCGCCTGCACGATCGTTGAGATGAGCCCCAGAGCGTCCACTCCTGTCAGCTG[C/T,A]
GCAATAGTAGCCATTCGATCCATGCCTTCCCACTGTAAATGTGCCATAGCTTCACTGCTTTCTCACCTTTCAGCCAGCAGCTGCCTGCTCTCAATCAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 3.20% 2.14% 7.24% NA
All Indica  2759 79.60% 5.40% 3.48% 11.56% NA
All Japonica  1512 99.70% 0.00% 0.20% 0.13% NA
Aus  269 92.90% 0.00% 0.00% 7.06% NA
Indica I  595 84.00% 0.00% 0.84% 15.13% NA
Indica II  465 62.40% 17.60% 12.47% 7.53% NA
Indica III  913 87.20% 0.40% 0.66% 11.72% NA
Indica Intermediate  786 77.50% 8.00% 3.44% 11.07% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 0.00% 1.24% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 0.00% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126943355 G -> T LOC_Os11g44560.1 synonymous_variant ; p.Ala445Ala; LOW N Average:47.356; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N
vg1126943355 G -> A LOC_Os11g44560.1 synonymous_variant ; p.Ala445Ala; LOW synonymous_codon Average:47.356; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N
vg1126943355 G -> DEL LOC_Os11g44560.1 N frameshift_variant Average:47.356; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126943355 2.08E-08 1.75E-09 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126943355 NA 8.61E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126943355 3.65E-11 9.90E-12 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126943355 3.99E-11 4.99E-12 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126943355 5.11E-11 2.32E-11 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126943355 1.58E-07 1.11E-08 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126943355 7.11E-08 7.11E-08 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251