Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126786095:

Variant ID: vg1126786095 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26786095
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCCCAAGAATATCATCCCTCCTTGAGGTGCCGGAGGGGCGCCGTCCACTCCGAAGGGTAAGCGGGGCCCTGGATCCGTCCACTAGCAAGGTACAGGCC[T/C]
TGCCTTGCCTTTGGAGGAGAAGGTTGCACGCGGGGCTTCAACATCGTTGAGGGAGGCATTAAATGCCTTACCCACCAACTGTTCGTGCGGCCATGCTGTA

Reverse complement sequence

TACAGCATGGCCGCACGAACAGTTGGTGGGTAAGGCATTTAATGCCTCCCTCAACGATGTTGAAGCCCCGCGTGCAACCTTCTCCTCCAAAGGCAAGGCA[A/G]
GGCCTGTACCTTGCTAGTGGACGGATCCAGGGCCCCGCTTACCCTTCGGAGTGGACGGCGCCCCTCCGGCACCTCAAGGAGGGATGATATTCTTGGGGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.00%	14.10%	0.55%	19.28%	NA
All Indica	2759	50.50%	23.00%	0.83%	25.66%	NA
All Japonica	1512	90.50%	0.50%	0.13%	8.86%	NA
Aus	269	72.90%	5.90%	0.00%	21.19%	NA
Indica I	595	57.30%	32.40%	0.50%	9.75%	NA
Indica II	465	46.20%	4.50%	1.72%	47.53%	NA
Indica III	913	45.50%	32.90%	0.22%	21.47%	NA
Indica Intermediate	786	53.80%	15.30%	1.27%	29.64%	NA
Temperate Japonica	767	89.40%	0.70%	0.26%	9.65%	NA
Tropical Japonica	504	93.70%	0.40%	0.00%	5.95%	NA
Japonica Intermediate	241	87.60%	0.00%	0.00%	12.45%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	75.60%	11.10%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126786095	T -> DEL	N	N	silent_mutation	Average:78.422; most accessible tissue: Zhenshan97 root, score: 94.079	N	N	N	N
vg1126786095	T -> C	LOC_Os11g44310.1	downstream_gene_variant ; 2122.0bp to feature; MODIFIER	silent_mutation	Average:78.422; most accessible tissue: Zhenshan97 root, score: 94.079	N	N	N	N
vg1126786095	T -> C	LOC_Os11g44330.1	downstream_gene_variant ; 4429.0bp to feature; MODIFIER	silent_mutation	Average:78.422; most accessible tissue: Zhenshan97 root, score: 94.079	N	N	N	N
vg1126786095	T -> C	LOC_Os11g44310-LOC_Os11g44330	intergenic_region ; MODIFIER	silent_mutation	Average:78.422; most accessible tissue: Zhenshan97 root, score: 94.079	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1126786095	T	C	-0.05	-0.01	-0.01	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126786095	NA	5.45E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126786095	9.91E-07	1.26E-07	mr1281	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126786095	7.53E-06	7.53E-06	mr1287	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126786095	NA	4.07E-06	mr1372	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126786095	7.22E-06	7.21E-06	mr1972	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251