Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126585651:

Variant ID: vg1126585651 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26585651
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 35. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGTTGGTCTTGGATCTTAGAGGAATATTCCTCTCCAGGGACTAACCCATTCCGCCCACCCCTAAACCAAACACCCCTAAAAGTGGGTTCGCCCCATCC[T/C]
ATCATATCCTTGCAACCAAACACTACCTCAGATGACATGCAACTGTGCAAGCAATGAGAGGACATCCCCTCGAGGGGTGAAAACAATTTTCCCTATTAAT

Reverse complement sequence

ATTAATAGGGAAAATTGTTTTCACCCCTCGAGGGGATGTCCTCTCATTGCTTGCACAGTTGCATGTCATCTGAGGTAGTGTTTGGTTGCAAGGATATGAT[A/G]
GGATGGGGCGAACCCACTTTTAGGGGTGTTTGGTTTAGGGGTGGGCGGAATGGGTTAGTCCCTGGAGAGGAATATTCCTCTAAGATCCAAGACCAACCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	36.80%	0.99%	5.27%	NA
All Indica	2759	58.90%	31.00%	1.30%	8.74%	NA
All Japonica	1512	50.10%	49.50%	0.07%	0.26%	NA
Aus	269	67.30%	29.70%	2.97%	0.00%	NA
Indica I	595	53.30%	39.30%	2.02%	5.38%	NA
Indica II	465	71.60%	24.50%	0.43%	3.44%	NA
Indica III	913	57.50%	24.50%	1.31%	16.65%	NA
Indica Intermediate	786	57.40%	36.10%	1.27%	5.22%	NA
Temperate Japonica	767	24.90%	74.70%	0.00%	0.39%	NA
Tropical Japonica	504	81.70%	18.10%	0.00%	0.20%	NA
Japonica Intermediate	241	64.30%	35.30%	0.41%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	47.80%	45.60%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126585651	T -> DEL	N	N	silent_mutation	Average:42.661; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg1126585651	T -> C	LOC_Os11g43990.1	upstream_gene_variant ; 3466.0bp to feature; MODIFIER	silent_mutation	Average:42.661; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg1126585651	T -> C	LOC_Os11g44014.1	downstream_gene_variant ; 1675.0bp to feature; MODIFIER	silent_mutation	Average:42.661; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg1126585651	T -> C	LOC_Os11g44000.1	intron_variant ; MODIFIER	silent_mutation	Average:42.661; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126585651	NA	4.57E-07	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585651	NA	3.73E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585651	NA	1.97E-08	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585651	NA	5.82E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585651	NA	3.17E-07	mr1570	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585651	NA	5.07E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585651	NA	8.76E-09	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585651	NA	9.46E-06	mr1958	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585651	6.26E-08	3.79E-15	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585651	NA	2.49E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585651	NA	3.71E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251