Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126542743:

Variant ID: vg1126542743 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 26542743
Reference Allele: AAlternative Allele: C,AGCGACACTATC
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, C: 0.07, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGACTTTAAGTATTACTTATCTTTTTTATATTTACACAAAATTTTCAAACAAAATTTTCAAATAAAACGAATAGCCAAACGTTAGAAGGAAAAAGTCA[A/C,AGCGACACTATC]
AGCGACGCTATTGTGGGACGGAGGAAGTACATGCCAACCGCTTGTGGGGCCCACCTCGATACACACACCGACCAGACCAGACCAGACCAGACCAGAGCCA

Reverse complement sequence

TGGCTCTGGTCTGGTCTGGTCTGGTCTGGTCGGTGTGTGTATCGAGGTGGGCCCCACAAGCGGTTGGCATGTACTTCCTCCGTCCCACAATAGCGTCGCT[T/G,GATAGTGTCGCT]
TGACTTTTTCCTTCTAACGTTTGGCTATTCGTTTTATTTGAAAATTTTGTTTGAAAATTTTGTGTAAATATAAAAAAGATAAGTAATACTTAAAGTCTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 9.00% 11.45% 11.66% AGCGACACTATC: 0.02%
All Indica  2759 52.30% 13.80% 14.97% 18.88% NA
All Japonica  1512 92.60% 0.70% 5.22% 1.46% AGCGACACTATC: 0.07%
Aus  269 79.90% 6.70% 12.27% 1.12% NA
Indica I  595 26.20% 29.90% 21.01% 22.86% NA
Indica II  465 69.90% 17.40% 2.80% 9.89% NA
Indica III  913 58.10% 2.50% 17.31% 22.12% NA
Indica Intermediate  786 55.10% 12.60% 14.89% 17.43% NA
Temperate Japonica  767 94.40% 1.30% 3.78% 0.39% AGCGACACTATC: 0.13%
Tropical Japonica  504 88.30% 0.00% 8.73% 2.98% NA
Japonica Intermediate  241 95.90% 0.00% 2.49% 1.66% NA
VI/Aromatic  96 92.70% 0.00% 7.29% 0.00% NA
Intermediate  90 68.90% 15.60% 10.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126542743 A -> AGCGACACTATC LOC_Os11g43950.1 upstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:98.66; most accessible tissue: Callus, score: 99.703 N N N N
vg1126542743 A -> AGCGACACTATC LOC_Os11g43934-LOC_Os11g43950 intergenic_region ; MODIFIER silent_mutation Average:98.66; most accessible tissue: Callus, score: 99.703 N N N N
vg1126542743 A -> DEL N N silent_mutation Average:98.66; most accessible tissue: Callus, score: 99.703 N N N N
vg1126542743 A -> C LOC_Os11g43950.1 upstream_gene_variant ; 94.0bp to feature; MODIFIER silent_mutation Average:98.66; most accessible tissue: Callus, score: 99.703 N N N N
vg1126542743 A -> C LOC_Os11g43934-LOC_Os11g43950 intergenic_region ; MODIFIER silent_mutation Average:98.66; most accessible tissue: Callus, score: 99.703 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126542743 A AGCGA* 0.06 0.05 -0.04 0.04 -0.01 -0.03
vg1126542743 A C -0.01 -0.01 -0.02 0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126542743 NA 3.83E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 NA 1.89E-08 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 4.86E-07 8.50E-10 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 NA 9.65E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 NA 9.16E-10 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 NA 6.21E-09 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 NA 5.34E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 5.80E-06 9.91E-08 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 NA 1.45E-15 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 2.44E-07 4.78E-15 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 1.17E-08 1.56E-11 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 1.31E-09 4.14E-11 mr1380_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 NA 5.87E-06 mr1522_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 1.35E-09 2.71E-13 mr1561_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 4.06E-10 1.13E-11 mr1561_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 NA 9.68E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 3.90E-06 2.96E-09 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 NA 3.39E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 6.62E-08 1.89E-11 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 3.05E-08 1.28E-09 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 6.75E-10 1.29E-13 mr1908_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 4.74E-09 3.15E-10 mr1908_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 3.01E-08 3.20E-10 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126542743 6.11E-09 1.81E-09 mr1996_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251