Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126520429:

Variant ID: vg1126520429 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26520429
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGGGTACGTCGCCTACCACTAAAAAAATTCGCTCCCATGGGGAGTCGAACCCAGGACCTCGGTGCTACTGAGGCTCTTATAACCACTAGGCTACAGGCT[C/A]
TTTCATGAAAAGTTAGAAGATTATGTGTGTAGAAAAGTTTGATGTGATGAAAAAGTTGAAAGTTTGTTTAAAAAAAATTGGATCTAAACACGGTCGTAGT

Reverse complement sequence

ACTACGACCGTGTTTAGATCCAATTTTTTTTAAACAAACTTTCAACTTTTTCATCACATCAAACTTTTCTACACACATAATCTTCTAACTTTTCATGAAA[G/T]
AGCCTGTAGCCTAGTGGTTATAAGAGCCTCAGTAGCACCGAGGTCCTGGGTTCGACTCCCCATGGGAGCGAATTTTTTTAGTGGTAGGCGACGTACCCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 28.00% 0.72% 32.18% NA
All Indica  2759 33.20% 44.60% 0.76% 21.46% NA
All Japonica  1512 53.00% 2.20% 0.60% 44.18% NA
Aus  269 30.50% 12.30% 0.74% 56.51% NA
Indica I  595 16.00% 40.70% 1.01% 42.35% NA
Indica II  465 12.70% 69.00% 1.51% 16.77% NA
Indica III  913 48.10% 39.20% 0.22% 12.49% NA
Indica Intermediate  786 41.10% 39.30% 0.76% 18.83% NA
Temperate Japonica  767 77.80% 2.20% 0.39% 19.56% NA
Tropical Japonica  504 23.40% 1.60% 0.60% 74.40% NA
Japonica Intermediate  241 36.10% 3.30% 1.24% 59.34% NA
VI/Aromatic  96 16.70% 6.20% 1.04% 76.04% NA
Intermediate  90 35.60% 23.30% 1.11% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126520429 C -> A LOC_Os11g43914.1 upstream_gene_variant ; 2370.0bp to feature; MODIFIER silent_mutation Average:82.891; most accessible tissue: Zhenshan97 panicle, score: 93.936 N N N N
vg1126520429 C -> A LOC_Os11g43920.1 downstream_gene_variant ; 1926.0bp to feature; MODIFIER silent_mutation Average:82.891; most accessible tissue: Zhenshan97 panicle, score: 93.936 N N N N
vg1126520429 C -> A LOC_Os11g43934.2 downstream_gene_variant ; 4479.0bp to feature; MODIFIER silent_mutation Average:82.891; most accessible tissue: Zhenshan97 panicle, score: 93.936 N N N N
vg1126520429 C -> A LOC_Os11g43920-LOC_Os11g43934 intergenic_region ; MODIFIER silent_mutation Average:82.891; most accessible tissue: Zhenshan97 panicle, score: 93.936 N N N N
vg1126520429 C -> DEL N N silent_mutation Average:82.891; most accessible tissue: Zhenshan97 panicle, score: 93.936 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126520429 C A -0.06 -0.04 -0.03 -0.03 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126520429 5.69E-06 1.89E-10 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 NA 1.05E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 2.90E-07 3.79E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 7.43E-08 7.43E-08 mr1644 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 NA 3.85E-08 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 4.07E-11 2.72E-19 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 5.14E-06 5.14E-06 mr1191_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 NA 3.16E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 9.38E-06 1.27E-12 mr1380_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 NA 1.21E-10 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 NA 1.61E-10 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 NA 8.01E-10 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 NA 1.33E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126520429 NA 8.46E-11 mr1996_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251