Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126445759:

Variant ID: vg1126445759 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26445759
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TCAACGACCAAAGTTTGAGGTATTCAAGTATTGCCTGAGTCCCAAGCGCGCCTCTTATGTCCTTGATCCATCTACGGTTAGACAGCGCTTCAGCCACCGT[T/C]
CGGCGCTTCCGGATACGAGTAGAGACATGATCGTAGATGGAGGGTGCAATAGCTCGGATGGTTCCTCCTTGCAACCAATTGTCCTCCCAGAAAAGGATTG

Reverse complement sequence

CAATCCTTTTCTGGGAGGACAATTGGTTGCAAGGAGGAACCATCCGAGCTATTGCACCCTCCATCTACGATCATGTCTCTACTCGTATCCGGAAGCGCCG[A/G]
ACGGTGGCTGAAGCGCTGTCTAACCGTAGATGGATCAAGGACATAAGAGGCGCGCTTGGGACTCAGGCAATACTTGAATACCTCAAACTTTGGTCGTTGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	46.40%	0.17%	0.06%	NA
All Indica	2759	29.20%	70.50%	0.22%	0.11%	NA
All Japonica	1512	92.30%	7.60%	0.07%	0.00%	NA
Aus	269	62.80%	36.80%	0.37%	0.00%	NA
Indica I	595	50.30%	49.20%	0.50%	0.00%	NA
Indica II	465	25.60%	73.80%	0.00%	0.65%	NA
Indica III	913	14.20%	85.70%	0.11%	0.00%	NA
Indica Intermediate	786	32.80%	66.90%	0.25%	0.00%	NA
Temperate Japonica	767	96.90%	3.10%	0.00%	0.00%	NA
Tropical Japonica	504	86.70%	13.30%	0.00%	0.00%	NA
Japonica Intermediate	241	89.60%	10.00%	0.41%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126445759	T -> DEL	LOC_Os11g43780.1	N	frameshift_variant	Average:49.777; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg1126445759	T -> C	LOC_Os11g43780.1	synonymous_variant ; p.Arg166Arg; LOW	synonymous_codon	Average:49.777; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126445759	NA	3.37E-07	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759	NA	8.37E-08	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759	4.49E-06	NA	mr1884	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759	1.39E-06	1.03E-13	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759	NA	6.17E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759	NA	3.79E-06	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759	NA	2.18E-07	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126445759	NA	1.45E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251