Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126252192:

Variant ID: vg1126252192 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26252192
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, G: 0.45, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

AGTATGCATGATATCTCACAAATAAAATTCAAATTTGTACATACACATTTATCCACCATCATCTCATCTACATGTGAGTTTCACCTAAGTTGGAGTTTAC[A/G]
TCATATATATGTGCATGCAAAGCACAGAAGTGTTGTCAGAGCTAAATGTGAGGAAGATGATAGTAGGTTGACGCAGGGCTGCGTTTAGTTCCATCCAAAG

Reverse complement sequence

CTTTGGATGGAACTAAACGCAGCCCTGCGTCAACCTACTATCATCTTCCTCACATTTAGCTCTGACAACACTTCTGTGCTTTGCATGCACATATATATGA[T/C]
GTAAACTCCAACTTAGGTGAAACTCACATGTAGATGAGATGATGGTGGATAAATGTGTATGTACAAATTTGAATTTTATTTGTGAGATATCATGCATACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.00%	39.90%	0.99%	14.13%	NA
All Indica	2759	30.10%	55.10%	0.47%	14.32%	NA
All Japonica	1512	77.70%	3.20%	2.18%	16.93%	NA
Aus	269	22.70%	77.30%	0.00%	0.00%	NA
Indica I	595	11.30%	53.90%	1.01%	33.78%	NA
Indica II	465	23.00%	60.20%	0.65%	16.13%	NA
Indica III	913	38.80%	53.30%	0.22%	7.67%	NA
Indica Intermediate	786	38.50%	55.00%	0.25%	6.23%	NA
Temperate Japonica	767	93.10%	1.00%	3.52%	2.35%	NA
Tropical Japonica	504	51.80%	3.40%	0.99%	43.85%	NA
Japonica Intermediate	241	83.00%	9.50%	0.41%	7.05%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	43.30%	36.70%	1.11%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126252192	A -> DEL	N	N	silent_mutation	Average:47.964; most accessible tissue: Zhenshan97 root, score: 82.733	N	N	N	N
vg1126252192	A -> G	LOC_Os11g43470.1	upstream_gene_variant ; 1038.0bp to feature; MODIFIER	silent_mutation	Average:47.964; most accessible tissue: Zhenshan97 root, score: 82.733	N	N	N	N
vg1126252192	A -> G	LOC_Os11g43480.1	upstream_gene_variant ; 1770.0bp to feature; MODIFIER	silent_mutation	Average:47.964; most accessible tissue: Zhenshan97 root, score: 82.733	N	N	N	N
vg1126252192	A -> G	LOC_Os11g43470-LOC_Os11g43480	intergenic_region ; MODIFIER	silent_mutation	Average:47.964; most accessible tissue: Zhenshan97 root, score: 82.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126252192	2.75E-07	5.17E-12	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126252192	NA	2.41E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126252192	2.71E-06	NA	mr1667	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126252192	3.57E-07	4.73E-11	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126252192	NA	1.29E-10	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126252192	NA	9.01E-06	mr1246_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126252192	NA	5.28E-09	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251