Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126223931:

Variant ID: vg1126223931 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26223931
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAAAAATGTTGTTTTTTTTTTGACAAATTTCTAGACTAAAACTACAGTCCTTAAAAGGAGGGAGTATATAAATGCAAACAGGAAGGTTGTTGGGAGGC[T/C]
GGGCCAAGCTAGGCTCCTCCACAGAATATATGATCATGCATGACATCATTGATTTTGTGACAAATGTTTCATCATTCATCCTATTCAAATTATTTTACAA

Reverse complement sequence

TTGTAAAATAATTTGAATAGGATGAATGATGAAACATTTGTCACAAAATCAATGATGTCATGCATGATCATATATTCTGTGGAGGAGCCTAGCTTGGCCC[A/G]
GCCTCCCAACAACCTTCCTGTTTGCATTTATATACTCCCTCCTTTTAAGGACTGTAGTTTTAGTCTAGAAATTTGTCAAAAAAAAAACAACATTTTTTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 1.40% 10.43% 25.88% NA
All Indica  2759 73.80% 0.80% 7.72% 17.69% NA
All Japonica  1512 34.10% 2.40% 17.13% 46.43% NA
Aus  269 97.40% 0.00% 0.74% 1.86% NA
Indica I  595 59.20% 0.30% 3.36% 37.14% NA
Indica II  465 74.20% 0.60% 6.45% 18.71% NA
Indica III  913 79.10% 1.20% 10.08% 9.64% NA
Indica Intermediate  786 78.50% 0.80% 9.03% 11.70% NA
Temperate Japonica  767 44.70% 2.30% 19.56% 33.38% NA
Tropical Japonica  504 18.50% 2.00% 12.30% 67.26% NA
Japonica Intermediate  241 32.80% 3.30% 19.50% 44.40% NA
VI/Aromatic  96 81.20% 4.20% 9.38% 5.21% NA
Intermediate  90 61.10% 2.20% 11.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126223931 T -> DEL N N silent_mutation Average:44.389; most accessible tissue: Zhenshan97 root, score: 91.92 N N N N
vg1126223931 T -> C LOC_Os11g43420.1 downstream_gene_variant ; 3178.0bp to feature; MODIFIER silent_mutation Average:44.389; most accessible tissue: Zhenshan97 root, score: 91.92 N N N N
vg1126223931 T -> C LOC_Os11g43430.1 downstream_gene_variant ; 1660.0bp to feature; MODIFIER silent_mutation Average:44.389; most accessible tissue: Zhenshan97 root, score: 91.92 N N N N
vg1126223931 T -> C LOC_Os11g43420-LOC_Os11g43430 intergenic_region ; MODIFIER silent_mutation Average:44.389; most accessible tissue: Zhenshan97 root, score: 91.92 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126223931 T C -0.09 -0.06 -0.02 -0.02 -0.09 -0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126223931 4.32E-06 2.38E-09 mr1133 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126223931 5.63E-06 NA mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126223931 NA 9.29E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126223931 NA 6.49E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251