Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126207622:

Variant ID: vg1126207622 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26207622
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CAAATCCTATGAAATTCCTATGGAATGGCACATTGCATGTGGATTTTGGAGGAAATTTAGCAAGAGCTCCAACCTCTTGGAAAATTTCCTTTGAGTCTAT[C/T]
TCTCTTATCCGATTCCTGTGTTTTTCCTGCGCTCCAATCAAACGACCATTCCTGTGTTTTTCCTGTGTTTTGCAATCCTCTGTTTTTCACTTCAATTCCT

Reverse complement sequence

AGGAATTGAAGTGAAAAACAGAGGATTGCAAAACACAGGAAAAACACAGGAATGGTCGTTTGATTGGAGCGCAGGAAAAACACAGGAATCGGATAAGAGA[G/A]
ATAGACTCAAAGGAAATTTTCCAAGAGGTTGGAGCTCTTGCTAAATTTCCTCCAAAATCCACATGCAATGTGCCATTCCATAGGAATTTCATAGGATTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	8.00%	0.83%	34.28%	NA
All Indica	2759	48.70%	12.50%	1.05%	37.69%	NA
All Japonica	1512	72.80%	0.60%	0.53%	26.06%	NA
Aus	269	45.40%	5.20%	0.00%	49.44%	NA
Indica I	595	26.90%	0.80%	1.01%	71.26%	NA
Indica II	465	57.60%	23.70%	0.00%	18.71%	NA
Indica III	913	50.60%	11.80%	1.20%	36.36%	NA
Indica Intermediate	786	57.80%	15.60%	1.53%	25.06%	NA
Temperate Japonica	767	95.60%	0.70%	0.26%	3.52%	NA
Tropical Japonica	504	40.70%	0.80%	0.79%	57.74%	NA
Japonica Intermediate	241	67.60%	0.00%	0.83%	31.54%	NA
VI/Aromatic	96	80.20%	0.00%	2.08%	17.71%	NA
Intermediate	90	52.20%	7.80%	0.00%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126207622	C -> T	LOC_Os11g43400.1	downstream_gene_variant ; 4907.0bp to feature; MODIFIER	silent_mutation	Average:49.339; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1126207622	C -> T	LOC_Os11g43404.1	downstream_gene_variant ; 1632.0bp to feature; MODIFIER	silent_mutation	Average:49.339; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1126207622	C -> T	LOC_Os11g43404.3	downstream_gene_variant ; 1632.0bp to feature; MODIFIER	silent_mutation	Average:49.339; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1126207622	C -> T	LOC_Os11g43404.2	downstream_gene_variant ; 1631.0bp to feature; MODIFIER	silent_mutation	Average:49.339; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1126207622	C -> T	LOC_Os11g43404.5	downstream_gene_variant ; 1631.0bp to feature; MODIFIER	silent_mutation	Average:49.339; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1126207622	C -> T	LOC_Os11g43404.6	downstream_gene_variant ; 1631.0bp to feature; MODIFIER	silent_mutation	Average:49.339; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1126207622	C -> T	LOC_Os11g43404.4	downstream_gene_variant ; 1608.0bp to feature; MODIFIER	silent_mutation	Average:49.339; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1126207622	C -> T	LOC_Os11g43404-LOC_Os11g43410	intergenic_region ; MODIFIER	silent_mutation	Average:49.339; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1126207622	C -> DEL	N	N	silent_mutation	Average:49.339; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126207622	6.95E-09	4.17E-09	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126207622	1.78E-07	4.51E-08	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126207622	5.20E-06	2.87E-07	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126207622	NA	1.96E-06	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126207622	1.50E-08	9.91E-11	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126207622	1.37E-08	3.45E-10	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126207622	NA	2.95E-08	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126207622	1.09E-08	3.52E-10	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126207622	6.35E-08	5.52E-10	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126207622	NA	8.17E-06	mr1944_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126207622	5.33E-07	5.33E-07	mr1945_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251