| Variant ID: vg1126102161 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26102161 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTGTTCTTATGCAAAAAAGAACAAGAAGTGTAGTTCCCAAAAAATAGAACAAGTGTAGTTCATCACAAAAAAAGAATAAGTGGAGGCCGACTGTTTGTA[T/C]
GAAAAAAGAACAAGTGTAGTTCCCAAAAAATATAACAAGTGTAGATAGTCTGTTCTTATGCAAAAACGAGAAAGTGTATTGCCCCCTAAGTAAAAAGAAC
GTTCTTTTTACTTAGGGGGCAATACACTTTCTCGTTTTTGCATAAGAACAGACTATCTACACTTGTTATATTTTTTGGGAACTACACTTGTTCTTTTTTC[A/G]
TACAAACAGTCGGCCTCCACTTATTCTTTTTTTGTGATGAACTACACTTGTTCTATTTTTTGGGAACTACACTTCTTGTTCTTTTTTGCATAAGAACAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.60% | 11.50% | 3.24% | 5.59% | NA |
| All Indica | 2759 | 88.10% | 5.10% | 3.52% | 3.19% | NA |
| All Japonica | 1512 | 66.50% | 23.70% | 1.52% | 8.33% | NA |
| Aus | 269 | 70.60% | 10.40% | 12.27% | 6.69% | NA |
| Indica I | 595 | 98.30% | 1.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 90.10% | 5.20% | 1.72% | 3.01% | NA |
| Indica III | 913 | 79.60% | 7.30% | 6.57% | 6.46% | NA |
| Indica Intermediate | 786 | 89.20% | 5.60% | 3.31% | 1.91% | NA |
| Temperate Japonica | 767 | 87.60% | 11.00% | 0.78% | 0.65% | NA |
| Tropical Japonica | 504 | 31.20% | 47.80% | 2.98% | 18.06% | NA |
| Japonica Intermediate | 241 | 73.00% | 13.70% | 0.83% | 12.45% | NA |
| VI/Aromatic | 96 | 74.00% | 1.00% | 0.00% | 25.00% | NA |
| Intermediate | 90 | 73.30% | 17.80% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126102161 | T -> DEL | N | N | silent_mutation | Average:50.723; most accessible tissue: Zhenshan97 flower, score: 73.414 | N | N | N | N |
| vg1126102161 | T -> C | LOC_Os11g43270.1 | upstream_gene_variant ; 4754.0bp to feature; MODIFIER | silent_mutation | Average:50.723; most accessible tissue: Zhenshan97 flower, score: 73.414 | N | N | N | N |
| vg1126102161 | T -> C | LOC_Os11g43260.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.723; most accessible tissue: Zhenshan97 flower, score: 73.414 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126102161 | 4.21E-06 | NA | mr1715 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126102161 | NA | 4.19E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126102161 | NA | 5.73E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126102161 | 3.73E-06 | NA | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126102161 | NA | 1.32E-06 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126102161 | 8.02E-06 | NA | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |