| Variant ID: vg1126095799 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26095799 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAAAGATCGTTTTTAGCACCGGTACAAATATTGTCAGACCGTGTCAGGTCCCTGGGATCTTTAGTATCAGTTGGTGTCACCAATCGGTACTAAAGATCAA[T/C]
ACTTTAGTACCGATTGGTATCACCAACTGATACTAAAGATTGTATTGATCAACCAACTGGTACTAAAGATAATGTCCTCCACTAGCTCTCTCTCCGTATA
TATACGGAGAGAGAGCTAGTGGAGGACATTATCTTTAGTACCAGTTGGTTGATCAATACAATCTTTAGTATCAGTTGGTGATACCAATCGGTACTAAAGT[A/G]
TTGATCTTTAGTACCGATTGGTGACACCAACTGATACTAAAGATCCCAGGGACCTGACACGGTCTGACAATATTTGTACCGGTGCTAAAAACGATCTTTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 2.80% | 3.77% | 10.98% | NA |
| All Indica | 2759 | 86.00% | 0.60% | 4.02% | 9.31% | NA |
| All Japonica | 1512 | 83.60% | 6.30% | 1.85% | 8.27% | NA |
| Aus | 269 | 57.60% | 7.40% | 8.92% | 26.02% | NA |
| Indica I | 595 | 71.10% | 0.20% | 9.58% | 19.16% | NA |
| Indica II | 465 | 90.10% | 0.20% | 3.44% | 6.24% | NA |
| Indica III | 913 | 90.70% | 1.40% | 1.31% | 6.57% | NA |
| Indica Intermediate | 786 | 89.60% | 0.30% | 3.31% | 6.87% | NA |
| Temperate Japonica | 767 | 89.20% | 9.60% | 0.26% | 0.91% | NA |
| Tropical Japonica | 504 | 78.80% | 1.20% | 2.58% | 17.46% | NA |
| Japonica Intermediate | 241 | 75.90% | 6.20% | 5.39% | 12.45% | NA |
| VI/Aromatic | 96 | 30.20% | 1.00% | 13.54% | 55.21% | NA |
| Intermediate | 90 | 82.20% | 0.00% | 2.22% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126095799 | T -> DEL | N | N | silent_mutation | Average:35.526; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg1126095799 | T -> C | LOC_Os11g43250.1 | upstream_gene_variant ; 4516.0bp to feature; MODIFIER | silent_mutation | Average:35.526; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg1126095799 | T -> C | LOC_Os11g43260.1 | downstream_gene_variant ; 2636.0bp to feature; MODIFIER | silent_mutation | Average:35.526; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg1126095799 | T -> C | LOC_Os11g43250-LOC_Os11g43260 | intergenic_region ; MODIFIER | silent_mutation | Average:35.526; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126095799 | NA | 8.47E-06 | mr1049_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126095799 | 2.67E-09 | 2.67E-09 | mr1191_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126095799 | 2.40E-06 | 2.40E-06 | mr1981_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |