Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126074837:

Variant ID: vg1126074837 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26074837
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTGACAGAGTGACAGAGTGGAAGCAGTTCAAGCAGTTGAAGTTTCGCTGATGTCTAAATATAATTAGCAGGTTGAAGCAAAGTGTAAGAACATTTAAG[G/C]
CTTAGTTATTTACAGATTACTAGCAATGTACCCGTGTGTTGCAATAGGAAATATAATTCGTTTACAATATAGAACGAGCTCTTCTACCGGCGAATCGATG

Reverse complement sequence

CATCGATTCGCCGGTAGAAGAGCTCGTTCTATATTGTAAACGAATTATATTTCCTATTGCAACACACGGGTACATTGCTAGTAATCTGTAAATAACTAAG[C/G]
CTTAAATGTTCTTACACTTTGCTTCAACCTGCTAATTATATTTAGACATCAGCGAAACTTCAACTGCTTGAACTGCTTCCACTCTGTCACTCTGTCAACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.10%	10.40%	7.60%	1.88%	NA
All Indica	2759	81.50%	9.90%	7.97%	0.58%	NA
All Japonica	1512	76.50%	11.20%	7.67%	4.56%	NA
Aus	269	78.80%	14.50%	6.32%	0.37%	NA
Indica I	595	80.50%	7.60%	11.26%	0.67%	NA
Indica II	465	74.00%	17.00%	8.17%	0.86%	NA
Indica III	913	87.30%	7.70%	4.60%	0.44%	NA
Indica Intermediate	786	80.00%	10.20%	9.29%	0.51%	NA
Temperate Japonica	767	96.30%	1.40%	1.30%	0.91%	NA
Tropical Japonica	504	41.50%	29.40%	18.06%	11.11%	NA
Japonica Intermediate	241	86.70%	4.60%	6.22%	2.49%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	7.80%	6.67%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126074837	G -> DEL	N	N	silent_mutation	Average:39.008; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg1126074837	G -> C	LOC_Os11g43220.1	downstream_gene_variant ; 87.0bp to feature; MODIFIER	silent_mutation	Average:39.008; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg1126074837	G -> C	LOC_Os11g43230.1	downstream_gene_variant ; 3016.0bp to feature; MODIFIER	silent_mutation	Average:39.008; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N
vg1126074837	G -> C	LOC_Os11g43220-LOC_Os11g43230	intergenic_region ; MODIFIER	silent_mutation	Average:39.008; most accessible tissue: Minghui63 root, score: 70.332	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126074837	4.01E-07	NA	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126074837	7.04E-08	2.11E-06	mr1644	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126074837	4.37E-06	NA	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126074837	4.22E-06	NA	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251