Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126054242:

Variant ID: vg1126054242 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26054242
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAAAAAGAAGAAAAAAGAAGGAAAAAAAAGAAGAAAATGACATGTCACGTCCATATGGCATGCCACATCAGCGCCACGTATGATCCTATAGGGGCTGT[G/A]
GCGATTTAGGATCTAGATGACACACTTTGACAAGTTCTGAAATCTGGATATACATTTTGAGAGTTTAAAAACCTAGATGACACAGCCCTACAAGTTTAAG

Reverse complement sequence

CTTAAACTTGTAGGGCTGTGTCATCTAGGTTTTTAAACTCTCAAAATGTATATCCAGATTTCAGAACTTGTCAAAGTGTGTCATCTAGATCCTAAATCGC[C/T]
ACAGCCCCTATAGGATCATACGTGGCGCTGATGTGGCATGCCATATGGACGTGACATGTCATTTTCTTCTTTTTTTTCCTTCTTTTTTCTTCTTTTTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.90%	4.40%	0.95%	2.69%	NA
All Indica	2759	87.20%	6.70%	1.56%	4.60%	NA
All Japonica	1512	98.90%	1.10%	0.07%	0.00%	NA
Aus	269	97.00%	2.60%	0.37%	0.00%	NA
Indica I	595	95.50%	3.00%	0.84%	0.67%	NA
Indica II	465	81.10%	11.80%	1.08%	6.02%	NA
Indica III	913	85.00%	5.90%	2.85%	6.24%	NA
Indica Intermediate	786	87.00%	7.30%	0.89%	4.83%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.20%	1.60%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126054242	G -> A	LOC_Os11g43180.1	upstream_gene_variant ; 585.0bp to feature; MODIFIER	silent_mutation	Average:78.871; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N
vg1126054242	G -> A	LOC_Os11g43200.1	downstream_gene_variant ; 3267.0bp to feature; MODIFIER	silent_mutation	Average:78.871; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N
vg1126054242	G -> A	LOC_Os11g43180-LOC_Os11g43200	intergenic_region ; MODIFIER	silent_mutation	Average:78.871; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N
vg1126054242	G -> DEL	N	N	silent_mutation	Average:78.871; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126054242	8.92E-10	1.06E-10	mr1238	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126054242	NA	5.39E-06	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126054242	7.80E-06	1.31E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126054242	1.97E-06	2.40E-07	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126054242	8.61E-07	5.13E-07	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126054242	7.30E-06	7.30E-06	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251