Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126030887:

Variant ID: vg1126030887 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26030887
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, T: 0.08, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGCCTTGTGGACAATTTCTTTGATTTGATCCTTGCCTAACATAGTAGCAGCAGCACTTGGTCCTAGTGCAGTGGACTTGGTGGTAGATTTATCCTGCT[T/G]
CAGTGGCGTGCTGCTGACTGTCGGGAACACTTCCCTCAGGATGTTTACATATTGCTTCTTACTGAGATGAATCTTGTTCACCTCTGATACTTCCATATGA

Reverse complement sequence

TCATATGGAAGTATCAGAGGTGAACAAGATTCATCTCAGTAAGAAGCAATATGTAAACATCCTGAGGGAAGTGTTCCCGACAGTCAGCAGCACGCCACTG[A/C]
AGCAGGATAAATCTACCACCAAGTCCACTGCACTAGGACCAAGTGCTGCTGCTACTATGTTAGGCAAGGATCAAATCAAAGAAATTGTCCACAAGGCTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.60%	41.20%	0.28%	2.92%	NA
All Indica	2759	64.40%	30.30%	0.29%	4.97%	NA
All Japonica	1512	41.10%	58.80%	0.07%	0.00%	NA
Aus	269	44.60%	54.30%	1.12%	0.00%	NA
Indica I	595	51.90%	47.40%	0.67%	0.00%	NA
Indica II	465	83.40%	16.10%	0.00%	0.43%	NA
Indica III	913	66.00%	20.60%	0.00%	13.36%	NA
Indica Intermediate	786	60.80%	37.00%	0.51%	1.65%	NA
Temperate Japonica	767	8.20%	91.80%	0.00%	0.00%	NA
Tropical Japonica	504	92.90%	7.10%	0.00%	0.00%	NA
Japonica Intermediate	241	37.80%	61.80%	0.41%	0.00%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	64.40%	33.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126030887	T -> DEL	LOC_Os11g43140.1	N	frameshift_variant	Average:66.23; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N
vg1126030887	T -> G	LOC_Os11g43140.1	missense_variant ; p.Lys469Gln; MODERATE	nonsynonymous_codon ; K469Q	Average:66.23; most accessible tissue: Zhenshan97 root, score: 87.373	unknown	unknown	TOLERATED	0.72

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1126030887	T	G	0.03	0.02	0.02	0.02	0.02	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126030887	NA	1.10E-14	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1126030887	2.36E-09	4.75E-10	mr1191	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030887	4.79E-07	1.52E-06	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030887	4.02E-09	4.39E-10	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030887	NA	5.61E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030887	NA	4.74E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030887	7.29E-12	NA	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030887	2.43E-08	2.39E-07	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030887	NA	5.94E-21	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030887	NA	2.90E-07	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126030887	NA	2.90E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251