Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125901132:

Variant ID: vg1125901132 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25901132
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGAGTTGGTGTGCCAATGGTTGTGGAATGCCGAGAATGAGGAGACGAAGTGTTACACATTTTTGCCCATCGTGGGTGTCTTTTTGCCTCTATTGTGGC[G/A]
TGGTACCGGTAGGAGTAGGAGGTATCCTCGGTATTTCCTGAGTGGATGATGGCTATCATTGCCTGATACTTGGCTATGGATCTTAGCCCAACTAGGTGGC

Reverse complement sequence

GCCACCTAGTTGGGCTAAGATCCATAGCCAAGTATCAGGCAATGATAGCCATCATCCACTCAGGAAATACCGAGGATACCTCCTACTCCTACCGGTACCA[C/T]
GCCACAATAGAGGCAAAAAGACACCCACGATGGGCAAAAATGTGTAACACTTCGTCTCCTCATTCTCGGCATTCCACAACCATTGGCACACCAACTCCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.00%	14.30%	8.63%	0.04%	NA
All Indica	2759	65.90%	21.10%	12.90%	0.07%	NA
All Japonica	1512	94.40%	3.90%	1.72%	0.00%	NA
Aus	269	82.20%	9.30%	8.55%	0.00%	NA
Indica I	595	65.50%	30.30%	4.20%	0.00%	NA
Indica II	465	76.60%	20.90%	2.58%	0.00%	NA
Indica III	913	50.90%	22.30%	26.51%	0.22%	NA
Indica Intermediate	786	77.40%	12.80%	9.80%	0.00%	NA
Temperate Japonica	767	98.00%	1.20%	0.78%	0.00%	NA
Tropical Japonica	504	89.90%	8.70%	1.39%	0.00%	NA
Japonica Intermediate	241	92.10%	2.50%	5.39%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	13.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125901132	G -> A	LOC_Os11g42970.1	upstream_gene_variant ; 3913.0bp to feature; MODIFIER	silent_mutation	Average:48.655; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg1125901132	G -> A	LOC_Os11g42980.1	upstream_gene_variant ; 3964.0bp to feature; MODIFIER	silent_mutation	Average:48.655; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg1125901132	G -> A	LOC_Os11g42970-LOC_Os11g42980	intergenic_region ; MODIFIER	silent_mutation	Average:48.655; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N
vg1125901132	G -> DEL	N	N	silent_mutation	Average:48.655; most accessible tissue: Zhenshan97 root, score: 70.636	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125901132	1.14E-10	1.03E-18	mr1191	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901132	1.03E-12	1.32E-16	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901132	5.43E-13	7.59E-22	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901132	4.01E-14	3.47E-19	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901132	5.00E-12	2.64E-27	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125901132	1.52E-14	5.57E-24	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251