Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125885112:

Variant ID: vg1125885112 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25885112
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AGCACAGAGGAGGTAGATGCACGGAGTGGGAGGAGGAGACGGCGGTGGTGGTGGCACTGCTTGGGGAAGAAGCCGGGGCACAGAGTAGGGGTGGTAATGA[T/C]
GCTACTTGGGGAACGAGCCAAGGAAAGGAGTTGTGGCGCGGAGTAGGGGTGGCGGCTGCATGGTCGTGTGAGGAGCCGAATTCGCGCGCGGTTGGGGATA

Reverse complement sequence

TATCCCCAACCGCGCGCGAATTCGGCTCCTCACACGACCATGCAGCCGCCACCCCTACTCCGCGCCACAACTCCTTTCCTTGGCTCGTTCCCCAAGTAGC[A/G]
TCATTACCACCCCTACTCTGTGCCCCGGCTTCTTCCCCAAGCAGTGCCACCACCACCGCCGTCTCCTCCTCCCACTCCGTGCATCTACCTCCTCTGTGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.40% 31.30% 0.36% 0.00% NA
All Indica  2759 75.30% 24.20% 0.43% 0.00% NA
All Japonica  1512 60.50% 39.50% 0.00% 0.00% NA
Aus  269 47.60% 51.70% 0.74% 0.00% NA
Indica I  595 53.60% 45.90% 0.50% 0.00% NA
Indica II  465 60.60% 38.90% 0.43% 0.00% NA
Indica III  913 94.60% 5.00% 0.33% 0.00% NA
Indica Intermediate  786 78.00% 21.50% 0.51% 0.00% NA
Temperate Japonica  767 39.00% 61.00% 0.00% 0.00% NA
Tropical Japonica  504 94.20% 5.80% 0.00% 0.00% NA
Japonica Intermediate  241 58.50% 41.50% 0.00% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 70.00% 26.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125885112 T -> C LOC_Os11g42930.1 upstream_gene_variant ; 2909.0bp to feature; MODIFIER silent_mutation Average:70.459; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1125885112 T -> C LOC_Os11g42940.1 downstream_gene_variant ; 1351.0bp to feature; MODIFIER silent_mutation Average:70.459; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg1125885112 T -> C LOC_Os11g42930-LOC_Os11g42940 intergenic_region ; MODIFIER silent_mutation Average:70.459; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125885112 T C 0.0 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125885112 NA 2.86E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 4.14E-10 1.47E-12 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 1.50E-10 3.83E-13 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 1.20E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 1.11E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 9.38E-06 2.05E-08 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 4.05E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 9.14E-06 2.44E-09 mr1561 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 4.90E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 2.00E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 5.86E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 2.27E-11 3.73E-18 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 9.70E-12 1.49E-16 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 3.77E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 1.12E-06 8.72E-10 mr1937 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 4.77E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 1.81E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 2.46E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 3.25E-13 3.67E-19 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 6.20E-12 7.48E-18 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 2.12E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 1.61E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 2.16E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125885112 NA 1.72E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251