| Variant ID: vg1125838014 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25838014 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, C: 0.16, others allele: 0.00, population size: 69. )
TTTCTGGTCTTCCGATATTTCCGATATCGTTTTCGTTTCCGACTTTACCGTTTCCGATTTCGTTTCCGAAAAAAATATGGTTACGGAAATTGTTGAGGCT[G/C]
TTTTCCGATCGTTTCCGACCGTTTTCATCCCTATTCACATATCAAAAATTTAAGAAACCATTTTATACGGGGAATAAAAACCCATAAATTTAATATATAA
TTATATATTAAATTTATGGGTTTTTATTCCCCGTATAAAATGGTTTCTTAAATTTTTGATATGTGAATAGGGATGAAAACGGTCGGAAACGATCGGAAAA[C/G]
AGCCTCAACAATTTCCGTAACCATATTTTTTTCGGAAACGAAATCGGAAACGGTAAAGTCGGAAACGAAAACGATATCGGAAATATCGGAAGACCAGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 33.40% | 1.10% | 26.81% | NA |
| All Indica | 2759 | 28.60% | 36.50% | 0.98% | 33.85% | NA |
| All Japonica | 1512 | 57.20% | 30.00% | 0.73% | 12.04% | NA |
| Aus | 269 | 24.20% | 28.30% | 1.49% | 46.10% | NA |
| Indica I | 595 | 41.70% | 42.50% | 0.50% | 15.29% | NA |
| Indica II | 465 | 55.50% | 28.60% | 0.65% | 15.27% | NA |
| Indica III | 913 | 9.90% | 43.30% | 1.31% | 45.56% | NA |
| Indica Intermediate | 786 | 24.70% | 28.90% | 1.15% | 45.29% | NA |
| Temperate Japonica | 767 | 42.90% | 40.30% | 0.52% | 16.30% | NA |
| Tropical Japonica | 504 | 73.60% | 18.30% | 0.40% | 7.74% | NA |
| Japonica Intermediate | 241 | 68.50% | 22.00% | 2.07% | 7.47% | NA |
| VI/Aromatic | 96 | 78.10% | 10.40% | 8.33% | 3.12% | NA |
| Intermediate | 90 | 36.70% | 34.40% | 2.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125838014 | G -> DEL | N | N | silent_mutation | Average:25.009; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1125838014 | G -> C | LOC_Os11g42890.1 | upstream_gene_variant ; 1316.0bp to feature; MODIFIER | silent_mutation | Average:25.009; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1125838014 | G -> C | LOC_Os11g42880.1 | downstream_gene_variant ; 4589.0bp to feature; MODIFIER | silent_mutation | Average:25.009; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1125838014 | G -> C | LOC_Os11g42900.1 | downstream_gene_variant ; 2579.0bp to feature; MODIFIER | silent_mutation | Average:25.009; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg1125838014 | G -> C | LOC_Os11g42890-LOC_Os11g42900 | intergenic_region ; MODIFIER | silent_mutation | Average:25.009; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125838014 | 4.54E-13 | 5.36E-16 | mr1191 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125838014 | 2.48E-16 | 2.06E-21 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125838014 | NA | 8.82E-06 | mr1380 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125838014 | NA | 4.12E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125838014 | NA | 4.30E-07 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125838014 | 9.11E-06 | NA | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125838014 | 1.28E-18 | 3.96E-23 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125838014 | 1.04E-21 | 1.36E-30 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125838014 | NA | 6.94E-06 | mr1937 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125838014 | 3.58E-16 | 6.48E-21 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125838014 | 8.46E-18 | 2.26E-26 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |