Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125795181:

Variant ID: vg1125795181 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25795181
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CGGAGCTTTGGCTTCTTTCCTCACCCACACTTTCTTCACCTTTTTCACTTTTTTCACCTTTGATCCACCGGACCGATTCTTTTGTGAGAAACGGTCTTGT[T/C]
TTGAATTAGATGAATGATTTGGCACTGTCCTAGGTGATTCCTTCCACTCTTCATGAAACGGCATACGCGGTTGATGCATCCATGGCATATAATACAAAAA

Reverse complement sequence

TTTTTGTATTATATGCCATGGATGCATCAACCGCGTATGCCGTTTCATGAAGAGTGGAAGGAATCACCTAGGACAGTGCCAAATCATTCATCTAATTCAA[A/G]
ACAAGACCGTTTCTCACAAAAGAATCGGTCCGGTGGATCAAAGGTGAAAAAAGTGAAAAAGGTGAAGAAAGTGTGGGTGAGGAAAGAAGCCAAAGCTCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 26.20% 2.09% 32.20% NA
All Indica  2759 35.90% 14.60% 2.43% 47.05% NA
All Japonica  1512 46.00% 43.90% 1.65% 8.47% NA
Aus  269 36.10% 42.00% 0.37% 21.56% NA
Indica I  595 36.80% 43.50% 0.50% 19.16% NA
Indica II  465 30.30% 4.90% 4.52% 60.22% NA
Indica III  913 37.10% 4.90% 2.19% 55.75% NA
Indica Intermediate  786 37.20% 9.70% 2.93% 50.25% NA
Temperate Japonica  767 25.40% 69.40% 0.13% 5.08% NA
Tropical Japonica  504 76.80% 9.10% 0.99% 13.10% NA
Japonica Intermediate  241 46.90% 35.70% 7.88% 9.54% NA
VI/Aromatic  96 41.70% 40.60% 3.12% 14.58% NA
Intermediate  90 51.10% 18.90% 3.33% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125795181 T -> DEL LOC_Os11g42830.1 N frameshift_variant Average:29.196; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg1125795181 T -> C LOC_Os11g42830.1 missense_variant ; p.Lys510Arg; MODERATE nonsynonymous_codon ; K510R Average:29.196; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 benign -0.424 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125795181 NA 2.96E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 3.67E-07 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 8.53E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 3.82E-08 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 5.63E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 1.86E-10 3.13E-11 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 1.67E-09 1.96E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 2.91E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 1.26E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 2.28E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 2.66E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 5.62E-08 mr1318 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 2.93E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 1.47E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 6.88E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 7.97E-08 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 5.54E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 6.19E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 4.02E-08 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 1.21E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 1.11E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 1.32E-11 5.73E-15 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 2.41E-13 1.64E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 2.69E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 4.83E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 1.95E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 4.42E-08 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 2.89E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 9.89E-06 mr1743 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 8.50E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 1.50E-07 mr1788 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 1.93E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 1.16E-08 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 3.43E-11 5.76E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 6.83E-13 1.99E-10 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 9.10E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125795181 NA 2.96E-08 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251