Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125740602:

Variant ID: vg1125740602 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25740602
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGAGGGGAGCCTCGGTATTCGTGTTCAATAATCAAAGAAGGTAAATGCAGCAATTGGGTAAGGCCTGCCAGCTATATTGCAAACCGAGGCCAAGTGTC[C/A]
AGTGTACTCCTAGGAAGGCATAGTTGCAGAATCAAAATACTTAATTTCAAAATTATAGGTTCAATTGATCAAAGGTGACTTGCCTTGCTCGAGATCTTGA

Reverse complement sequence

TCAAGATCTCGAGCAAGGCAAGTCACCTTTGATCAATTGAACCTATAATTTTGAAATTAAGTATTTTGATTCTGCAACTATGCCTTCCTAGGAGTACACT[G/T]
GACACTTGGCCTCGGTTTGCAATATAGCTGGCAGGCCTTACCCAATTGCTGCATTTACCTTCTTTGATTATTGAACACGAATACCGAGGCTCCCCTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.70%	0.30%	7.47%	59.52%	NA
All Indica	2759	30.50%	0.40%	10.44%	58.68%	NA
All Japonica	1512	39.00%	0.10%	1.59%	59.39%	NA
Aus	269	28.30%	0.70%	9.67%	61.34%	NA
Indica I	595	58.80%	0.00%	5.04%	36.13%	NA
Indica II	465	36.10%	0.00%	11.61%	52.26%	NA
Indica III	913	13.70%	1.00%	11.17%	74.15%	NA
Indica Intermediate	786	25.20%	0.30%	12.98%	61.58%	NA
Temperate Japonica	767	60.90%	0.00%	1.56%	37.55%	NA
Tropical Japonica	504	12.30%	0.20%	2.38%	85.12%	NA
Japonica Intermediate	241	24.90%	0.00%	0.00%	75.10%	NA
VI/Aromatic	96	8.30%	0.00%	8.33%	83.33%	NA
Intermediate	90	35.60%	0.00%	7.78%	56.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125740602	C -> A	LOC_Os11g42740.1	upstream_gene_variant ; 917.0bp to feature; MODIFIER	silent_mutation	Average:11.724; most accessible tissue: Callus, score: 42.069	N	N	N	N
vg1125740602	C -> A	LOC_Os11g42720.1	downstream_gene_variant ; 3599.0bp to feature; MODIFIER	silent_mutation	Average:11.724; most accessible tissue: Callus, score: 42.069	N	N	N	N
vg1125740602	C -> A	LOC_Os11g42730.1	downstream_gene_variant ; 2446.0bp to feature; MODIFIER	silent_mutation	Average:11.724; most accessible tissue: Callus, score: 42.069	N	N	N	N
vg1125740602	C -> A	LOC_Os11g42730-LOC_Os11g42740	intergenic_region ; MODIFIER	silent_mutation	Average:11.724; most accessible tissue: Callus, score: 42.069	N	N	N	N
vg1125740602	C -> DEL	N	N	silent_mutation	Average:11.724; most accessible tissue: Callus, score: 42.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125740602	3.24E-06	NA	Grain_length	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125740602	NA	9.94E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125740602	NA	9.55E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125740602	NA	1.17E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125740602	NA	1.45E-06	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125740602	NA	2.03E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125740602	NA	4.41E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251