Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125670940:

Variant ID: vg1125670940 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25670940
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTTTACGTCGGCCGATGAATTGGAAGAAATTGATATAGGAATAGGTGATAGGCCTAGGCCGACGTATGTAAGCGCTAATTTGCCAAAGGAATACAAGA[A/G,T]
TAATTTGATAGATCTTTTGAAAGAATTCAGAGATTGTTTTGCATGGGAATACCATGAGATGCCAGGATTAAGCCGATCGATTGTAGAACATCGGCTACCA

Reverse complement sequence

TGGTAGCCGATGTTCTACAATCGATCGGCTTAATCCTGGCATCTCATGGTATTCCCATGCAAAACAATCTCTGAATTCTTTCAAAAGATCTATCAAATTA[T/C,A]
TCTTGTATTCCTTTGGCAAATTAGCGCTTACATACGTCGGCCTAGGCCTATCACCTATTCCTATATCAATTTCTTCCAATTCATCGGCCGACGTAAAACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 8.80% 7.07% 21.33% NA
All Indica  2759 62.00% 9.10% 7.07% 21.86% NA
All Japonica  1512 66.60% 3.60% 7.47% 22.29% NA
Aus  269 60.60% 22.30% 5.58% 11.52% NA
Indica I  595 86.20% 3.20% 1.85% 8.74% NA
Indica II  465 65.40% 6.50% 4.30% 23.87% NA
Indica III  913 46.20% 14.00% 11.39% 28.37% NA
Indica Intermediate  786 60.10% 9.30% 7.63% 23.03% NA
Temperate Japonica  767 82.80% 2.00% 3.39% 11.86% NA
Tropical Japonica  504 43.70% 6.50% 12.10% 37.70% NA
Japonica Intermediate  241 63.10% 2.90% 10.79% 23.24% NA
VI/Aromatic  96 31.20% 37.50% 6.25% 25.00% NA
Intermediate  90 64.40% 15.60% 5.56% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125670940 A -> T LOC_Os11g42630.1 missense_variant ; p.Asn1079Ile; MODERATE N Average:68.635; most accessible tissue: Minghui63 flag leaf, score: 94.184 N N N N
vg1125670940 A -> T LOC_Os11g42640.1 downstream_gene_variant ; 3680.0bp to feature; MODIFIER N Average:68.635; most accessible tissue: Minghui63 flag leaf, score: 94.184 N N N N
vg1125670940 A -> DEL LOC_Os11g42630.1 N frameshift_variant Average:68.635; most accessible tissue: Minghui63 flag leaf, score: 94.184 N N N N
vg1125670940 A -> G LOC_Os11g42630.1 missense_variant ; p.Asn1079Ser; MODERATE nonsynonymous_codon Average:68.635; most accessible tissue: Minghui63 flag leaf, score: 94.184 unknown unknown DELETERIOUS 0.00
vg1125670940 A -> G LOC_Os11g42630.1 missense_variant ; p.Asn1079Ser; MODERATE nonsynonymous_codon Average:68.635; most accessible tissue: Minghui63 flag leaf, score: 94.184 unknown unknown TOLERATED 0.14

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125670940 A G 0.01 0.0 0.0 0.0 0.0 0.0
vg1125670940 A T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125670940 9.33E-07 4.49E-09 mr1125 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125670940 NA 1.91E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125670940 NA 2.16E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251