| Variant ID: vg1125609759 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25609759 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 122. )
TCCCCCCTCCCCGTCACCTCCTTCGTCGCACTGCAGACGAGAGGGACGAGGGAGCGAGAGGAGGCGGCATCAAGTTTGTTGGATCTAGCTCCCGCCACAC[C/A,T]
ATCGTACCTTCTCCCTAACTGTGCTGTCGCTGTACTTTCTACACGACTGCTCCGCCGATGCATCCGCATTAATTGGCAAAAAAAATAGTGGTCATTTTCC
GGAAAATGACCACTATTTTTTTTGCCAATTAATGCGGATGCATCGGCGGAGCAGTCGTGTAGAAAGTACAGCGACAGCACAGTTAGGGAGAAGGTACGAT[G/T,A]
GTGTGGCGGGAGCTAGATCCAACAAACTTGATGCCGCCTCCTCTCGCTCCCTCGTCCCTCTCGTCTGCAGTGCGACGAAGGAGGTGACGGGGAGGGGGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.90% | 14.30% | 0.74% | 0.00% | NA |
| All Indica | 2759 | 85.00% | 14.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 87.80% | 10.10% | 2.05% | 0.00% | NA |
| Aus | 269 | 74.30% | 25.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.30% | 2.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.20% | 16.70% | 5.16% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.80% | 26.10% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125609759 | C -> T | LOC_Os11g42525.1 | upstream_gene_variant ; 2026.0bp to feature; MODIFIER | N | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> T | LOC_Os11g42530.1 | upstream_gene_variant ; 3624.0bp to feature; MODIFIER | N | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> T | LOC_Os11g42540.1 | upstream_gene_variant ; 4747.0bp to feature; MODIFIER | N | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> T | LOC_Os11g42540.2 | upstream_gene_variant ; 4747.0bp to feature; MODIFIER | N | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> T | LOC_Os11g42520.1 | downstream_gene_variant ; 963.0bp to feature; MODIFIER | N | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> T | LOC_Os11g42520-LOC_Os11g42525 | intergenic_region ; MODIFIER | N | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> A | LOC_Os11g42525.1 | upstream_gene_variant ; 2026.0bp to feature; MODIFIER | silent_mutation | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> A | LOC_Os11g42530.1 | upstream_gene_variant ; 3624.0bp to feature; MODIFIER | silent_mutation | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> A | LOC_Os11g42540.1 | upstream_gene_variant ; 4747.0bp to feature; MODIFIER | silent_mutation | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> A | LOC_Os11g42540.2 | upstream_gene_variant ; 4747.0bp to feature; MODIFIER | silent_mutation | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> A | LOC_Os11g42520.1 | downstream_gene_variant ; 963.0bp to feature; MODIFIER | silent_mutation | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| vg1125609759 | C -> A | LOC_Os11g42520-LOC_Os11g42525 | intergenic_region ; MODIFIER | silent_mutation | Average:75.978; most accessible tissue: Callus, score: 96.87 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125609759 | 6.87E-12 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | 7.51E-13 | 5.14E-10 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | NA | 4.72E-08 | mr1511 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | NA | 2.98E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | 1.02E-14 | 1.05E-08 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | 8.63E-17 | 8.22E-12 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | NA | 1.48E-06 | mr1651 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | NA | 1.12E-06 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | NA | 3.93E-06 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | 7.77E-15 | NA | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | 1.27E-18 | 3.53E-11 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125609759 | NA | 7.54E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |