Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125603546:

Variant ID: vg1125603546 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25603546
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TAAATTGGAGGAGTACCTTTTTTTATGACACTTTTGGAATCCATTGCTGACAAATATTTATAAATGAATGATATTATGACATCGATATCGAGAACTGTCA[T/C]
GTTTTATAGTGTAAATTTTGATACCTTTTAAAATCTAATGTATCGTGAGGTACCAAATTTACGAATGGTAATATAGTCCATAAATTATTTTCGCAATGTG

Reverse complement sequence

CACATTGCGAAAATAATTTATGGACTATATTACCATTCGTAAATTTGGTACCTCACGATACATTAGATTTTAAAAGGTATCAAAATTTACACTATAAAAC[A/G]
TGACAGTTCTCGATATCGATGTCATAATATCATTCATTTATAAATATTTGTCAGCAATGGATTCCAAAAGTGTCATAAAAAAAGGTACTCCTCCAATTTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.60%	37.20%	0.25%	0.00%	NA
All Indica	2759	49.10%	50.50%	0.36%	0.00%	NA
All Japonica	1512	89.90%	10.10%	0.00%	0.00%	NA
Aus	269	49.80%	50.20%	0.00%	0.00%	NA
Indica I	595	89.60%	9.90%	0.50%	0.00%	NA
Indica II	465	41.70%	57.40%	0.86%	0.00%	NA
Indica III	913	30.20%	69.70%	0.11%	0.00%	NA
Indica Intermediate	786	44.90%	54.80%	0.25%	0.00%	NA
Temperate Japonica	767	93.40%	6.60%	0.00%	0.00%	NA
Tropical Japonica	504	83.30%	16.70%	0.00%	0.00%	NA
Japonica Intermediate	241	92.50%	7.50%	0.00%	0.00%	NA
VI/Aromatic	96	44.80%	55.20%	0.00%	0.00%	NA
Intermediate	90	72.20%	25.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125603546	T -> C	LOC_Os11g42510.1	upstream_gene_variant ; 1128.0bp to feature; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Callus, score: 85.361	N	N	N	N
vg1125603546	T -> C	LOC_Os11g42520.1	upstream_gene_variant ; 4862.0bp to feature; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Callus, score: 85.361	N	N	N	N
vg1125603546	T -> C	LOC_Os11g42510.2	upstream_gene_variant ; 57.0bp to feature; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Callus, score: 85.361	N	N	N	N
vg1125603546	T -> C	LOC_Os11g42510-LOC_Os11g42520	intergenic_region ; MODIFIER	silent_mutation	Average:59.58; most accessible tissue: Callus, score: 85.361	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125603546	4.42E-07	3.92E-07	mr1133	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546	NA	1.60E-07	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546	5.90E-06	5.90E-06	mr1644	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546	NA	3.10E-06	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546	NA	3.20E-08	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546	1.69E-06	8.58E-09	mr1133_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546	1.71E-09	1.71E-09	mr1191_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546	NA	6.21E-07	mr1496_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546	NA	1.05E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125603546	NA	2.21E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251