Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125581911:

Variant ID: vg1125581911 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25581911
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

TCTGACCGTTGGGCCATGCCTGCCTCTGCCTTGACACGATGGGCTGGCCTAGCACATCAGGAAAAATAGAGTACGGACACAAATTGGACTTATCAGCCAT[A/G]
TAAGTACAGGCCAAAGAGTTAAGGGACACAGAATAGACTTATAACAGCCATATAGGATCCGCATAGGAGCACAGTAAACTTTCGTACCTTCGAGCTGACC

Reverse complement sequence

GGTCAGCTCGAAGGTACGAAAGTTTACTGTGCTCCTATGCGGATCCTATATGGCTGTTATAAGTCTATTCTGTGTCCCTTAACTCTTTGGCCTGTACTTA[T/C]
ATGGCTGATAAGTCCAATTTGTGTCCGTACTCTATTTTTCCTGATGTGCTAGGCCAGCCCATCGTGTCAAGGCAGAGGCAGGCATGGCCCAACGGTCAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.90%	10.10%	0.04%	0.00%	NA
All Indica	2759	83.00%	17.00%	0.07%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.20%	1.70%	0.17%	0.00%	NA
Indica II	465	80.90%	18.90%	0.22%	0.00%	NA
Indica III	913	77.90%	22.10%	0.00%	0.00%	NA
Indica Intermediate	786	78.60%	21.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125581911	A -> G	LOC_Os11g42470.1	upstream_gene_variant ; 399.0bp to feature; MODIFIER	silent_mutation	Average:92.204; most accessible tissue: Zhenshan97 root, score: 99.771	N	N	N	N
vg1125581911	A -> G	LOC_Os11g42480.1	downstream_gene_variant ; 2053.0bp to feature; MODIFIER	silent_mutation	Average:92.204; most accessible tissue: Zhenshan97 root, score: 99.771	N	N	N	N
vg1125581911	A -> G	LOC_Os11g42450-LOC_Os11g42470	intergenic_region ; MODIFIER	silent_mutation	Average:92.204; most accessible tissue: Zhenshan97 root, score: 99.771	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1125581911	A	G	0.04	0.03	0.02	0.02	0.02	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125581911	1.05E-06	NA	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	4.36E-08	5.42E-10	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	3.56E-07	2.89E-10	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	3.61E-07	1.11E-07	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	2.55E-11	2.31E-14	mr1644	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	5.98E-11	2.92E-11	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	NA	1.07E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	NA	8.15E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	NA	7.87E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	NA	2.11E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	1.27E-08	NA	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	1.83E-07	2.06E-07	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	NA	3.85E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125581911	NA	5.38E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251