Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125571040:

Variant ID: vg1125571040 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25571040
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTTATAAACTTTTGACTTATAAACTTTGGGTCTCTAAACTTTAGATGTGTAAACTTTACTAAAATAGAAAAGTAATGCGGTGCCAAAAAAGGAAACCA[T/C]
GTGGAGGAGGGGGGCTGATCGCTCCAGGCAATCAATCGCCTGCTAGCCTTTTCGAATGTGAATGGTAACAGCCTAATTAACAGAGAAACATATTCGATAC

Reverse complement sequence

GTATCGAATATGTTTCTCTGTTAATTAGGCTGTTACCATTCACATTCGAAAAGGCTAGCAGGCGATTGATTGCCTGGAGCGATCAGCCCCCCTCCTCCAC[A/G]
TGGTTTCCTTTTTTGGCACCGCATTACTTTTCTATTTTAGTAAAGTTTACACATCTAAAGTTTAGAGACCCAAAGTTTATAAGTCAAAAGTTTATAACAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	5.40%	4.40%	0.63%	NA
All Indica	2759	83.80%	9.10%	5.98%	1.05%	NA
All Japonica	1512	99.30%	0.20%	0.46%	0.07%	NA
Aus	269	87.00%	0.00%	13.01%	0.00%	NA
Indica I	595	58.30%	32.30%	9.41%	0.00%	NA
Indica II	465	97.00%	1.70%	1.08%	0.22%	NA
Indica III	913	86.40%	1.00%	9.53%	3.07%	NA
Indica Intermediate	786	92.40%	5.50%	2.16%	0.00%	NA
Temperate Japonica	767	99.20%	0.00%	0.78%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.20%	0.20%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125571040	T -> DEL	N	N	silent_mutation	Average:26.165; most accessible tissue: Callus, score: 67.351	N	N	N	N
vg1125571040	T -> C	LOC_Os11g42450-LOC_Os11g42470	intergenic_region ; MODIFIER	silent_mutation	Average:26.165; most accessible tissue: Callus, score: 67.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125571040	1.05E-10	NA	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125571040	4.62E-08	6.24E-07	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125571040	NA	5.92E-08	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125571040	6.20E-14	NA	mr1644	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125571040	7.72E-12	9.19E-09	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125571040	NA	7.70E-07	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125571040	1.67E-17	NA	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125571040	1.42E-13	1.26E-08	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251