Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125500282:

Variant ID: vg1125500282 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25500282
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGATCCAAATCCAGCGTGCACCTAGGAAGCACCAAATTGAACAACCTCATGTAACTAGTATAAAATTCAAGCATCGACACAGAATCAGACTTGATGTGA[C/T]
GGAAAGTTACGTGTGTATAAAATGTTTGATGTGATGGACAGTTGGAAGTTTAAAAAAAAACTTTGAAACTACACACACCTTTAGTTAAGTTCTACATAGT

Reverse complement sequence

ACTATGTAGAACTTAACTAAAGGTGTGTGTAGTTTCAAAGTTTTTTTTTAAACTTCCAACTGTCCATCACATCAAACATTTTATACACACGTAACTTTCC[G/A]
TCACATCAAGTCTGATTCTGTGTCGATGCTTGAATTTTATACTAGTTACATGAGGTTGTTCAATTTGGTGCTTCCTAGGTGCACGCTGGATTTGGATCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.30%	22.50%	3.89%	19.30%	NA
All Indica	2759	45.70%	21.50%	5.76%	27.04%	NA
All Japonica	1512	68.70%	21.20%	0.86%	9.33%	NA
Aus	269	66.20%	27.90%	3.35%	2.60%	NA
Indica I	595	45.20%	44.00%	2.02%	8.74%	NA
Indica II	465	51.20%	35.90%	3.87%	9.03%	NA
Indica III	913	42.10%	3.90%	5.91%	48.08%	NA
Indica Intermediate	786	47.10%	16.30%	9.54%	27.10%	NA
Temperate Japonica	767	93.40%	5.00%	0.26%	1.43%	NA
Tropical Japonica	504	27.20%	50.20%	2.18%	20.44%	NA
Japonica Intermediate	241	76.80%	12.00%	0.00%	11.20%	NA
VI/Aromatic	96	46.90%	53.10%	0.00%	0.00%	NA
Intermediate	90	51.10%	25.60%	3.33%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125500282	C -> T	LOC_Os11g42370.1	upstream_gene_variant ; 1304.0bp to feature; MODIFIER	silent_mutation	Average:65.038; most accessible tissue: Minghui63 root, score: 86.528	N	N	N	N
vg1125500282	C -> T	LOC_Os11g42350.1	downstream_gene_variant ; 3428.0bp to feature; MODIFIER	silent_mutation	Average:65.038; most accessible tissue: Minghui63 root, score: 86.528	N	N	N	N
vg1125500282	C -> T	LOC_Os11g42360.1	downstream_gene_variant ; 1754.0bp to feature; MODIFIER	silent_mutation	Average:65.038; most accessible tissue: Minghui63 root, score: 86.528	N	N	N	N
vg1125500282	C -> T	LOC_Os11g42380.1	downstream_gene_variant ; 3173.0bp to feature; MODIFIER	silent_mutation	Average:65.038; most accessible tissue: Minghui63 root, score: 86.528	N	N	N	N
vg1125500282	C -> T	LOC_Os11g42350.2	downstream_gene_variant ; 3428.0bp to feature; MODIFIER	silent_mutation	Average:65.038; most accessible tissue: Minghui63 root, score: 86.528	N	N	N	N
vg1125500282	C -> T	LOC_Os11g42350.3	downstream_gene_variant ; 3408.0bp to feature; MODIFIER	silent_mutation	Average:65.038; most accessible tissue: Minghui63 root, score: 86.528	N	N	N	N
vg1125500282	C -> T	LOC_Os11g42360-LOC_Os11g42370	intergenic_region ; MODIFIER	silent_mutation	Average:65.038; most accessible tissue: Minghui63 root, score: 86.528	N	N	N	N
vg1125500282	C -> DEL	N	N	silent_mutation	Average:65.038; most accessible tissue: Minghui63 root, score: 86.528	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125500282	4.25E-13	5.14E-18	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	1.82E-09	1.19E-11	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	NA	7.04E-06	mr1530	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	6.90E-12	5.23E-20	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	1.32E-07	2.60E-10	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	2.54E-25	8.33E-34	mr1662	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	4.63E-16	7.17E-21	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	6.31E-07	1.47E-08	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	NA	3.15E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	NA	2.11E-07	mr1745	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	NA	3.59E-07	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	4.98E-16	2.00E-27	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	3.29E-11	1.58E-18	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	NA	4.02E-08	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	5.68E-26	3.49E-42	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	3.68E-17	5.66E-25	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	9.03E-07	7.26E-09	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125500282	NA	2.61E-08	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251