Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125471656:

Variant ID: vg1125471656 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25471656
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAAATCCATTCAAAATCAGTCAAAATTTTAAAAAATTTCGTACGAAAAAAATTCCGAAATTTCGGTTCTATCGCTCCCCCTCGGCAGAAACCTAATTT[C/T]
GAAATTTGAAACCCTGGCCGGAGCGCGCCGAACGCGCCGCAAGAGCACGCTGTGGTGGTGGCGGCCTCCACGGCGGAGGAGGAGGTCGTCGGGGAGTTCG

Reverse complement sequence

CGAACTCCCCGACGACCTCCTCCTCCGCCGTGGAGGCCGCCACCACCACAGCGTGCTCTTGCGGCGCGTTCGGCGCGCTCCGGCCAGGGTTTCAAATTTC[G/A]
AAATTAGGTTTCTGCCGAGGGGGAGCGATAGAACCGAAATTTCGGAATTTTTTTCGTACGAAATTTTTTAAAATTTTGACTGATTTTGAATGGATTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.00%	19.60%	0.06%	0.32%	NA
All Indica	2759	73.10%	26.70%	0.11%	0.04%	NA
All Japonica	1512	91.10%	8.90%	0.00%	0.00%	NA
Aus	269	80.70%	14.50%	0.00%	4.83%	NA
Indica I	595	95.50%	4.40%	0.17%	0.00%	NA
Indica II	465	95.50%	4.30%	0.00%	0.22%	NA
Indica III	913	44.50%	55.50%	0.00%	0.00%	NA
Indica Intermediate	786	76.30%	23.40%	0.25%	0.00%	NA
Temperate Japonica	767	99.00%	1.00%	0.00%	0.00%	NA
Tropical Japonica	504	80.00%	20.00%	0.00%	0.00%	NA
Japonica Intermediate	241	89.60%	10.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	18.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125471656	C -> T	LOC_Os11g42290.1	upstream_gene_variant ; 3525.0bp to feature; MODIFIER	silent_mutation	Average:49.912; most accessible tissue: Minghui63 root, score: 84.447	N	N	N	N
vg1125471656	C -> T	LOC_Os11g42300.1	downstream_gene_variant ; 2494.0bp to feature; MODIFIER	silent_mutation	Average:49.912; most accessible tissue: Minghui63 root, score: 84.447	N	N	N	N
vg1125471656	C -> T	LOC_Os11g42290-LOC_Os11g42300	intergenic_region ; MODIFIER	silent_mutation	Average:49.912; most accessible tissue: Minghui63 root, score: 84.447	N	N	N	N
vg1125471656	C -> DEL	N	N	silent_mutation	Average:49.912; most accessible tissue: Minghui63 root, score: 84.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125471656	NA	1.43E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656	1.78E-15	1.91E-16	mr1662	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656	2.16E-08	2.82E-08	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656	NA	5.41E-06	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656	1.27E-14	1.22E-17	mr1662_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656	6.96E-07	2.45E-08	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125471656	8.61E-06	2.27E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251