Search for Variation information by Variation ID:
Detailed information for vg1125425266:
| Variant ID: vg1125425266 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25425266 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 245. )
Flanking Sequence (100 bp) in Reference Genome:
ACATCGAAGGGCGTGTACACGGAGGACTTCCCCATCCGGCCGCCGCGGCCTTTCAACTACACCAACCGTGATCTCATCCCTCCCGGCCCGCTCGAGGAGG[C/T]
GTTGGAGCCGACGTTCAAGGCGACCAAGCTGAAGCGGTTCAAGTACAACACATCGGTGGAGATCATCTTCCAGAGCACCACGCTGATGCAGAGCGACTCC
Reverse complement sequence
GGAGTCGCTCTGCATCAGCGTGGTGCTCTGGAAGATGATCTCCACCGATGTGTTGTACTTGAACCGCTTCAGCTTGGTCGCCTTGAACGTCGGCTCCAAC[G/A]
CCTCCTCGAGCGGGCCGGGAGGGATGAGATCACGGTTGGTGTAGTTGAAAGGCCGCGGCGGCCGGATGGGGAAGTCCTCCGTGTACACGCCCTTCGATGT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 16.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 78.30% | 21.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 90.40% | 9.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 58.60% | 41.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 0.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 78.20% | 21.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125425266 | C -> T | LOC_Os11g42200.1 | missense_variant ; p.Ala449Val; MODERATE | nonsynonymous_codon ; A449V | Average:65.611; most accessible tissue: Zhenshan97 young leaf, score: 85.886 | benign  |
0.404 |
TOLERATED | 0.24 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125425266 | NA | 5.07E-09 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125425266 | 3.43E-12 | 4.78E-14 | mr1662 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125425266 | 1.24E-07 | 3.32E-08 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125425266 | NA | 2.52E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125425266 | 5.59E-10 | 1.56E-12 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125425266 | NA | 2.01E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125425266 | 8.07E-06 | 5.89E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125425266 | NA | 4.05E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |