Variant ID: vg1125402847 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 25402847 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCAAATATGGAAACCGAACATGAGCCACAGCAAGTGCAACCCACTCTCTTGGACCTTCATGTCTGGCACCAATATTTCAACTAGGCACCTACAAATTGG[G/A]
CGCAATCGGGCGCTATTTCACCAAGTAGATTGAACATGTTTCACTAAATATATCGAAAATATTTCAGTCTTTTAAAAAGCTGAAACATAATCAAATCACC
GGTGATTTGATTATGTTTCAGCTTTTTAAAAGACTGAAATATTTTCGATATATTTAGTGAAACATGTTCAATCTACTTGGTGAAATAGCGCCCGATTGCG[C/T]
CCAATTTGTAGGTGCCTAGTTGAAATATTGGTGCCAGACATGAAGGTCCAAGAGAGTGGGTTGCACTTGCTGTGGCTCATGTTCGGTTTCCATATTTGAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.80% | 6.10% | 0.06% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 81.30% | 18.50% | 0.20% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 53.20% | 46.40% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 90.00% | 9.50% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1125402847 | G -> A | LOC_Os11g42160.1 | downstream_gene_variant ; 3543.0bp to feature; MODIFIER | silent_mutation | Average:30.89; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
vg1125402847 | G -> A | LOC_Os11g42170.1 | downstream_gene_variant ; 2170.0bp to feature; MODIFIER | silent_mutation | Average:30.89; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
vg1125402847 | G -> A | LOC_Os11g42180.1 | downstream_gene_variant ; 3241.0bp to feature; MODIFIER | silent_mutation | Average:30.89; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
vg1125402847 | G -> A | LOC_Os11g42170-LOC_Os11g42180 | intergenic_region ; MODIFIER | silent_mutation | Average:30.89; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1125402847 | NA | 7.45E-06 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125402847 | NA | 4.85E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125402847 | NA | 4.40E-06 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125402847 | 9.98E-08 | NA | mr1925 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125402847 | NA | 8.45E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |