Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125360972:

Variant ID: vg1125360972 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25360972
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, T: 0.18, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAAATTACACTGAAATTATTCACAAAGGAAACATGCTCACTACAATTCTTCGTGCACGAAGAGTTACATTTCCTCAAGATGTTAGGGCCTGTTTGTTT[G/T]
AGTTGTAAAATTGATTGGGTCGAAGAAAATAGATGAATATTAATGCATGTTTATAGCCCATAGTACCACACCAACTGAGCCAAATAGCAATCGGGCTCTA

Reverse complement sequence

TAGAGCCCGATTGCTATTTGGCTCAGTTGGTGTGGTACTATGGGCTATAAACATGCATTAATATTCATCTATTTTCTTCGACCCAATCAATTTTACAACT[C/A]
AAACAAACAGGCCCTAACATCTTGAGGAAATGTAACTCTTCGTGCACGAAGAATTGTAGTGAGCATGTTTCCTTTGTGAATAATTTCAGTGTAATTTTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.50%	24.00%	0.57%	38.95%	NA
All Indica	2759	24.40%	17.40%	0.83%	57.45%	NA
All Japonica	1512	53.50%	33.60%	0.20%	12.70%	NA
Aus	269	59.90%	26.00%	0.00%	14.13%	NA
Indica I	595	14.30%	45.50%	0.67%	39.50%	NA
Indica II	465	55.10%	21.50%	0.86%	22.58%	NA
Indica III	913	12.00%	3.30%	0.88%	83.79%	NA
Indica Intermediate	786	28.10%	9.90%	0.89%	61.07%	NA
Temperate Japonica	767	81.10%	16.40%	0.13%	2.35%	NA
Tropical Japonica	504	16.50%	54.80%	0.20%	28.57%	NA
Japonica Intermediate	241	43.20%	44.00%	0.41%	12.45%	NA
VI/Aromatic	96	53.10%	46.90%	0.00%	0.00%	NA
Intermediate	90	35.60%	34.40%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125360972	G -> T	LOC_Os11g42110.1	upstream_gene_variant ; 455.0bp to feature; MODIFIER	silent_mutation	Average:16.013; most accessible tissue: Callus, score: 82.835	N	N	N	N
vg1125360972	G -> T	LOC_Os11g42100.1	downstream_gene_variant ; 753.0bp to feature; MODIFIER	silent_mutation	Average:16.013; most accessible tissue: Callus, score: 82.835	N	N	N	N
vg1125360972	G -> T	LOC_Os11g42100-LOC_Os11g42110	intergenic_region ; MODIFIER	silent_mutation	Average:16.013; most accessible tissue: Callus, score: 82.835	N	N	N	N
vg1125360972	G -> DEL	N	N	silent_mutation	Average:16.013; most accessible tissue: Callus, score: 82.835	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125360972	NA	9.84E-07	mr1157	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972	1.60E-07	3.20E-12	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972	NA	5.02E-08	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972	NA	5.37E-08	mr1328	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972	NA	1.01E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972	8.94E-12	3.27E-19	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972	2.05E-07	3.74E-12	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972	NA	3.34E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972	NA	4.53E-06	mr1826	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972	NA	3.39E-16	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125360972	NA	2.32E-11	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251