Search for Variation information by Variation ID:
Detailed information for vg1125343326:
| Variant ID: vg1125343326 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25343326 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GAATCTGTGAGGCATTCGAGTAAGTGATGCACATCCAAGAACACTAAGATACTCAAGGCTATTAATTTTACTGATGTTCTGAGGTAATTCAGAAAGATAG[C/T]
GGCATCCTTCAAGGTCTAACTTGTGTAGCCGAGAAAGCCTGCATATATTTCGATGCAGTTTTTGGAGCTTTCCACAGTAGGATAATTTCAGAGTATGCAG
Reverse complement sequence
CTGCATACTCTGAAATTATCCTACTGTGGAAAGCTCCAAAAACTGCATCGAAATATATGCAGGCTTTCTCGGCTACACAAGTTAGACCTTGAAGGATGCC[G/A]
CTATCTTTCTGAATTACCTCAGAACATCAGTAAAATTAATAGCCTTGAGTATCTTAGTGTTCTTGGATGTGCATCACTTACTCGAATGCCTCACAGATTC
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.00% | 16.50% | 0.63% | 53.79% | NA |
| All Indica | 2759 | 35.00% | 4.20% | 0.54% | 60.24% | NA |
| All Japonica | 1512 | 18.50% | 35.70% | 0.79% | 45.04% | NA |
| Aus | 269 | 34.60% | 21.90% | 0.37% | 43.12% | NA |
| Indica I | 595 | 52.90% | 5.00% | 0.84% | 41.18% | NA |
| Indica II | 465 | 72.00% | 2.40% | 0.43% | 25.16% | NA |
| Indica III | 913 | 8.70% | 4.30% | 0.33% | 86.75% | NA |
| Indica Intermediate | 786 | 30.20% | 4.60% | 0.64% | 64.63% | NA |
| Temperate Japonica | 767 | 26.50% | 55.10% | 1.17% | 17.21% | NA |
| Tropical Japonica | 504 | 6.50% | 10.10% | 0.60% | 82.74% | NA |
| Japonica Intermediate | 241 | 17.80% | 27.40% | 0.00% | 54.77% | NA |
| VI/Aromatic | 96 | 4.20% | 53.10% | 1.04% | 41.67% | NA |
| Intermediate | 90 | 33.30% | 17.80% | 1.11% | 47.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125343326 | C -> T | LOC_Os11g42090.1 | missense_variant ; p.Arg656His; MODERATE | nonsynonymous_codon ; R656Q | Average:10.882; most accessible tissue: Callus, score: 57.928 | benign  |
-1.059 |
TOLERATED | 0.40 |
| vg1125343326 | C -> T | LOC_Os11g42090.1 | missense_variant ; p.Arg656His; MODERATE | nonsynonymous_codon ; R656H | Average:10.882; most accessible tissue: Callus, score: 57.928 | benign |
-1.386 |
TOLERATED | 0.64 |
| vg1125343326 | C -> DEL | LOC_Os11g42090.1 | N | frameshift_variant | Average:10.882; most accessible tissue: Callus, score: 57.928 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125343326 | NA | 2.14E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125343326 | 1.65E-06 | NA | mr1484 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125343326 | NA | 4.40E-06 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125343326 | 2.81E-07 | NA | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125343326 | 7.12E-06 | 7.12E-06 | mr1945 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125343326 | NA | 3.78E-07 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125343326 | NA | 7.87E-06 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |