Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125256577:

Variant ID: vg1125256577 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25256577
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTACATTTTCAAACTCAATAACTCGAGAGTTATTCATGATTTATATTTTCAAGGTTTGACTTAAACATTGTCATAAACGATTTTCTTTACGAGTACGGAG[A/G]
GAGGACATGATTTATGATTAAAGTCTGTTGAAATCAATCATTTGGAACATGCTATTATATGTTTTTTTTAACTTACTCAGACTTCTCTGTAATTTTTTTC

Reverse complement sequence

GAAAAAAATTACAGAGAAGTCTGAGTAAGTTAAAAAAAACATATAATAGCATGTTCCAAATGATTGATTTCAACAGACTTTAATCATAAATCATGTCCTC[T/C]
CTCCGTACTCGTAAAGAAAATCGTTTATGACAATGTTTAAGTCAAACCTTGAAAATATAAATCATGAATAACTCTCGAGTTATTGAGTTTGAAAATGTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 13.00% 0.85% 3.32% NA
All Indica  2759 89.50% 6.10% 0.83% 3.62% NA
All Japonica  1512 79.10% 18.20% 0.33% 2.38% NA
Aus  269 41.60% 47.60% 4.46% 6.32% NA
Indica I  595 93.60% 6.40% 0.00% 0.00% NA
Indica II  465 84.70% 1.10% 3.01% 11.18% NA
Indica III  913 91.30% 8.30% 0.00% 0.33% NA
Indica Intermediate  786 87.00% 6.10% 1.15% 5.73% NA
Temperate Japonica  767 96.60% 3.10% 0.00% 0.26% NA
Tropical Japonica  504 50.80% 44.60% 0.79% 3.77% NA
Japonica Intermediate  241 82.60% 10.80% 0.41% 6.22% NA
VI/Aromatic  96 59.40% 38.50% 0.00% 2.08% NA
Intermediate  90 87.80% 10.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125256577 A -> DEL N N silent_mutation Average:85.857; most accessible tissue: Minghui63 young leaf, score: 95.77 N N N N
vg1125256577 A -> G LOC_Os11g41990.1 upstream_gene_variant ; 3810.0bp to feature; MODIFIER silent_mutation Average:85.857; most accessible tissue: Minghui63 young leaf, score: 95.77 N N N N
vg1125256577 A -> G LOC_Os11g42000.1 upstream_gene_variant ; 1307.0bp to feature; MODIFIER silent_mutation Average:85.857; most accessible tissue: Minghui63 young leaf, score: 95.77 N N N N
vg1125256577 A -> G LOC_Os11g41990.2 upstream_gene_variant ; 3810.0bp to feature; MODIFIER silent_mutation Average:85.857; most accessible tissue: Minghui63 young leaf, score: 95.77 N N N N
vg1125256577 A -> G LOC_Os11g41990-LOC_Os11g42000 intergenic_region ; MODIFIER silent_mutation Average:85.857; most accessible tissue: Minghui63 young leaf, score: 95.77 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125256577 A G 0.04 0.02 0.01 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125256577 1.48E-08 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 8.05E-13 8.92E-14 mr1238 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 8.14E-06 1.42E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 1.70E-07 9.30E-08 mr1309 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 4.29E-08 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 5.30E-06 2.94E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 8.01E-08 1.11E-10 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 NA 3.84E-07 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 8.85E-07 6.31E-08 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 NA 9.70E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 1.05E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 5.99E-09 1.16E-09 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 8.59E-07 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 9.19E-09 1.48E-09 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 3.85E-06 8.17E-09 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 NA 5.00E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 2.13E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 8.61E-09 5.21E-10 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256577 9.48E-06 4.87E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251