Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125253130:

Variant ID: vg1125253130 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25253130
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TAAATATTACTATTTTTTTCTACAAAATTAATCAAACTTAGAGTAGTTTGAATTTGACCAAAGTCAGAACGTCGTATAACCTGAAACGGAGGGAGTATCT[C/T]
TTTACAAGGAATAATTAACGTTTTAAAAACTTTGGCTGGTAATGATTAACAAATTAGCATTAGTGTGAGCTAGTGTGTATGTGAAGTTGTTACAGGTGGT

Reverse complement sequence

ACCACCTGTAACAACTTCACATACACACTAGCTCACACTAATGCTAATTTGTTAATCATTACCAGCCAAAGTTTTTAAAACGTTAATTATTCCTTGTAAA[G/A]
AGATACTCCCTCCGTTTCAGGTTATACGACGTTCTGACTTTGGTCAAATTCAAACTACTCTAAGTTTGATTAATTTTGTAGAAAAAAATAGTAATATTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.00%	40.20%	0.28%	0.59%	NA
All Indica	2759	50.10%	49.60%	0.22%	0.04%	NA
All Japonica	1512	76.70%	22.00%	0.33%	0.99%	NA
Aus	269	53.90%	41.30%	0.37%	4.46%	NA
Indica I	595	63.70%	36.30%	0.00%	0.00%	NA
Indica II	465	9.90%	89.50%	0.65%	0.00%	NA
Indica III	913	60.90%	38.90%	0.22%	0.00%	NA
Indica Intermediate	786	51.10%	48.60%	0.13%	0.13%	NA
Temperate Japonica	767	93.60%	5.70%	0.65%	0.00%	NA
Tropical Japonica	504	49.20%	49.40%	0.00%	1.39%	NA
Japonica Intermediate	241	80.10%	16.60%	0.00%	3.32%	NA
VI/Aromatic	96	51.00%	49.00%	0.00%	0.00%	NA
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125253130	C -> T	LOC_Os11g41990.1	upstream_gene_variant ; 363.0bp to feature; MODIFIER	silent_mutation	Average:81.133; most accessible tissue: Minghui63 root, score: 94.189	N	N	N	N
vg1125253130	C -> T	LOC_Os11g42000.1	upstream_gene_variant ; 4754.0bp to feature; MODIFIER	silent_mutation	Average:81.133; most accessible tissue: Minghui63 root, score: 94.189	N	N	N	N
vg1125253130	C -> T	LOC_Os11g41990.2	upstream_gene_variant ; 363.0bp to feature; MODIFIER	silent_mutation	Average:81.133; most accessible tissue: Minghui63 root, score: 94.189	N	N	N	N
vg1125253130	C -> T	LOC_Os11g41990-LOC_Os11g42000	intergenic_region ; MODIFIER	silent_mutation	Average:81.133; most accessible tissue: Minghui63 root, score: 94.189	N	N	N	N
vg1125253130	C -> DEL	N	N	silent_mutation	Average:81.133; most accessible tissue: Minghui63 root, score: 94.189	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1125253130	C	T	-0.03	0.0	0.0	-0.01	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125253130	1.35E-16	1.32E-22	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125253130	3.89E-14	7.23E-13	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125253130	2.50E-24	3.18E-30	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125253130	1.02E-20	1.91E-16	mr1644	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125253130	5.66E-06	NA	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125253130	NA	2.24E-07	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125253130	4.61E-23	1.06E-30	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125253130	5.01E-18	1.59E-15	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125253130	NA	9.18E-09	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125253130	1.71E-06	1.42E-08	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125253130	NA	4.34E-07	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251