Search for Variation information by Variation ID:
Detailed information for vg1125249514:
| Variant ID: vg1125249514 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25249514 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TATTGAGCGCAAAGCTTTTCCATGGTCCAGCAGTGCAAATCTTGAAGCAACTTCCCAGTTATTTCTTATGATTGCAGTCAAAGAATCTAAGCAAGCATCC[C/T]
GTAGATTCATGGAGCCTCCAAAATGGTTAACAAGTCTCTGCGGAACTCCAGCAGCACATAGTGCTAATTGTTCTGTAGTGCTATCACAAGAGTGAGATAT
Reverse complement sequence
ATATCTCACTCTTGTGATAGCACTACAGAACAATTAGCACTATGTGCTGCTGGAGTTCCGCAGAGACTTGTTAACCATTTTGGAGGCTCCATGAATCTAC[G/A]
GGATGCTTGCTTAGATTCTTTGACTGCAATCATAAGAAATAACTGGGAAGTTGCTTCAAGATTTGCACTGCTGGACCATGGAAAAGCTTTGCGCTCAATA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.70% | 2.00% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.90% | 6.10% | 0.99% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.10% | 2.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 87.50% | 10.30% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 8.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125249514 | C -> T | LOC_Os11g41990.1 | missense_variant ; p.Arg240Gln; MODERATE | nonsynonymous_codon ; R240Q | Average:53.209; most accessible tissue: Callus, score: 76.11 | benign  |
1.092 |
DELETERIOUS | 0.01 |
| vg1125249514 | C -> T | LOC_Os11g41990.2 | missense_variant ; p.Arg240Gln; MODERATE | nonsynonymous_codon ; R240Q | Average:53.209; most accessible tissue: Callus, score: 76.11 | benign |
1.092 |
DELETERIOUS | 0.01 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125249514 | 4.89E-06 | 1.96E-14 | mr1769 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125249514 | NA | 5.23E-10 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125249514 | NA | 5.41E-06 | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125249514 | NA | 5.90E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125249514 | NA | 5.98E-16 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125249514 | NA | 5.94E-06 | mr1951_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |