Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125245628:

Variant ID: vg1125245628 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25245628
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 145. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGATGACTTCTTGAGTTCTAATAAAACATTTAATTTATCTCTTCATTTAAGTCTTAAATGCATAAAAACTATAAATAGGAACAACTTATTTGGAAAAA[C/A]
TCAAATGTGAAATAGGTGAAACTTTTGTGGATGGAGGGAGTAAAATAGGAGTATGTATAATTAGGCTAAGGCTGAAAAATATAGGTACTACTATCAACTT

Reverse complement sequence

AAGTTGATAGTAGTACCTATATTTTTCAGCCTTAGCCTAATTATACATACTCCTATTTTACTCCCTCCATCCACAAAAGTTTCACCTATTTCACATTTGA[G/T]
TTTTTCCAAATAAGTTGTTCCTATTTATAGTTTTTATGCATTTAAGACTTAAATGAAGAGATAAATTAAATGTTTTATTAGAACTCAAGAAGTCATCTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.50%	39.70%	0.23%	0.55%	NA
All Indica	2759	44.70%	54.90%	0.33%	0.00%	NA
All Japonica	1512	85.60%	13.40%	0.13%	0.93%	NA
Aus	269	61.30%	34.20%	0.00%	4.46%	NA
Indica I	595	38.20%	61.70%	0.17%	0.00%	NA
Indica II	465	58.70%	40.60%	0.65%	0.00%	NA
Indica III	913	43.30%	56.60%	0.11%	0.00%	NA
Indica Intermediate	786	43.10%	56.40%	0.51%	0.00%	NA
Temperate Japonica	767	97.50%	2.50%	0.00%	0.00%	NA
Tropical Japonica	504	69.20%	29.20%	0.40%	1.19%	NA
Japonica Intermediate	241	81.70%	14.90%	0.00%	3.32%	NA
VI/Aromatic	96	60.40%	39.60%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125245628	C -> A	LOC_Os11g41990.1	downstream_gene_variant ; 154.0bp to feature; MODIFIER	silent_mutation	Average:56.963; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N
vg1125245628	C -> A	LOC_Os11g41990.2	downstream_gene_variant ; 154.0bp to feature; MODIFIER	silent_mutation	Average:56.963; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N
vg1125245628	C -> A	LOC_Os11g41970-LOC_Os11g41990	intergenic_region ; MODIFIER	silent_mutation	Average:56.963; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N
vg1125245628	C -> DEL	N	N	silent_mutation	Average:56.963; most accessible tissue: Minghui63 young leaf, score: 74.514	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125245628	1.04E-06	4.54E-10	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245628	NA	7.68E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245628	3.72E-06	NA	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245628	3.15E-08	1.46E-13	mr1644	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245628	5.22E-06	7.21E-07	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245628	NA	1.23E-11	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245628	8.41E-06	7.07E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251