Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125234228:

Variant ID: vg1125234228 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 25234228
Reference Allele: GA	Alternative Allele: AA,G,GAA
Primary Allele: AA	Secondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAGACATAGCTACATTATCTGCTTCTATCGTTCGTGTCCTCCAAAGAACTGATCAGAATAGTAGTAGCACACGCTGAGTTGCAGGTAATTTCAGGAAG[GA/AA,G,GAA]
AAAAAAAAAACCTTGGGTCAGACCACCGTTGTCACTGTGGGGTAAACTCCAGAAGACAGAGAAAGCTAAAGATATGTCCTAGGTATGTTTTCTCTAGGAA

Reverse complement sequence

TTCCTAGAGAAAACATACCTAGGACATATCTTTAGCTTTCTCTGTCTTCTGGAGTTTACCCCACAGTGACAACGGTGGTCTGACCCAAGGTTTTTTTTTT[TC/TT,C,TTC]
CTTCCTGAAATTACCTGCAACTCAGCGTGTGCTACTACTATTCTGATCAGTTCTTTGGAGGACACGAACGATAGAAGCAGATAATGTAGCTATGTCTAAT

Allele Frequencies:

Populations	Population Size	Frequency of AA(primary allele)	Frequency of GA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.00%	27.30%	1.67%	39.76%	G: 1.21%
All Indica	2759	37.10%	3.50%	1.63%	57.19%	G: 0.54%
All Japonica	1512	19.30%	65.20%	0.99%	14.29%	G: 0.20%
Aus	269	24.90%	35.70%	5.58%	21.93%	G: 11.90%
Indica I	595	34.80%	2.50%	1.01%	61.68%	NA
Indica II	465	40.20%	4.10%	3.66%	51.83%	G: 0.22%
Indica III	913	41.00%	2.50%	0.99%	55.09%	G: 0.44%
Indica Intermediate	786	32.60%	5.10%	1.65%	59.41%	G: 1.27%
Temperate Japonica	767	4.00%	93.00%	0.26%	2.35%	G: 0.39%
Tropical Japonica	504	46.40%	20.80%	1.39%	31.35%	NA
Japonica Intermediate	241	11.20%	69.70%	2.49%	16.60%	NA
VI/Aromatic	96	8.30%	87.50%	1.04%	1.04%	G: 2.08%
Intermediate	90	31.10%	32.20%	3.33%	27.78%	G: 5.56%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125234228	GA -> GAA	LOC_Os11g41950.1	upstream_gene_variant ; 3307.0bp to feature; MODIFIER	N	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> GAA	LOC_Os11g41960.1	downstream_gene_variant ; 1501.0bp to feature; MODIFIER	N	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> GAA	LOC_Os11g41970.1	downstream_gene_variant ; 592.0bp to feature; MODIFIER	N	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> GAA	LOC_Os11g41960-LOC_Os11g41970	intergenic_region ; MODIFIER	N	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> AA	LOC_Os11g41950.1	upstream_gene_variant ; 3305.0bp to feature; MODIFIER	silent_mutation	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> AA	LOC_Os11g41960.1	downstream_gene_variant ; 1499.0bp to feature; MODIFIER	silent_mutation	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> AA	LOC_Os11g41970.1	downstream_gene_variant ; 594.0bp to feature; MODIFIER	silent_mutation	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> AA	LOC_Os11g41960-LOC_Os11g41970	intergenic_region ; MODIFIER	silent_mutation	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> DEL	N	N	silent_mutation	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> G	LOC_Os11g41950.1	upstream_gene_variant ; 3306.0bp to feature; MODIFIER	silent_mutation	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> G	LOC_Os11g41960.1	downstream_gene_variant ; 1500.0bp to feature; MODIFIER	silent_mutation	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> G	LOC_Os11g41970.1	downstream_gene_variant ; 593.0bp to feature; MODIFIER	silent_mutation	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N
vg1125234228	GA -> G	LOC_Os11g41960-LOC_Os11g41970	intergenic_region ; MODIFIER	silent_mutation	Average:31.075; most accessible tissue: Callus, score: 91.462	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125234228	1.12E-15	2.49E-23	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	1.09E-17	3.61E-20	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	NA	6.21E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	NA	1.52E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	NA	2.23E-07	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	5.31E-20	9.08E-29	mr1644	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	1.13E-21	7.32E-24	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	3.24E-06	NA	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	NA	1.54E-06	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	NA	1.79E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	NA	8.61E-06	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	NA	1.68E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	NA	1.73E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	1.10E-16	3.00E-32	mr1191_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	2.10E-19	4.66E-25	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	NA	1.34E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125234228	NA	9.45E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251