| Variant ID: vg1125225529 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25225529 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTGACGGAATGACTTGGTTCCAATTTTAGAATAGTAGAGTAGCATCTAACCGATTAGTAATAGTAATGATTTGATTTTGCTTTTCTCCAATCCTACAAAA[C/T]
TGGGAAGCATTGTTCTGCTTAGATAATCTACACTGATGTGACAATTTAACGCCGTTTGTGTAAGTTATTAAAACTGGTCTTTTTTTTTTCAGTTGGGAAA
TTTCCCAACTGAAAAAAAAAAGACCAGTTTTAATAACTTACACAAACGGCGTTAAATTGTCACATCAGTGTAGATTATCTAAGCAGAACAATGCTTCCCA[G/A]
TTTTGTAGGATTGGAGAAAAGCAAAATCAAATCATTACTATTACTAATCGGTTAGATGCTACTCTACTATTCTAAAATTGGAACCAAGTCATTCCGTCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 2.60% | 4.99% | 4.99% | NA |
| All Indica | 2759 | 85.60% | 2.80% | 5.94% | 5.62% | NA |
| All Japonica | 1512 | 88.40% | 2.50% | 4.30% | 4.83% | NA |
| Aus | 269 | 98.10% | 0.40% | 0.37% | 1.12% | NA |
| Indica I | 595 | 91.80% | 1.80% | 5.21% | 1.18% | NA |
| Indica II | 465 | 98.50% | 0.20% | 0.65% | 0.65% | NA |
| Indica III | 913 | 77.50% | 3.70% | 8.43% | 10.30% | NA |
| Indica Intermediate | 786 | 82.80% | 3.90% | 6.74% | 6.49% | NA |
| Temperate Japonica | 767 | 99.20% | 0.10% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 71.80% | 6.20% | 10.12% | 11.90% | NA |
| Japonica Intermediate | 241 | 88.40% | 2.50% | 4.56% | 4.56% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 7.80% | 6.67% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125225529 | C -> T | LOC_Os11g41940.1 | upstream_gene_variant ; 139.0bp to feature; MODIFIER | silent_mutation | Average:41.661; most accessible tissue: Callus, score: 76.689 | N | N | N | N |
| vg1125225529 | C -> T | LOC_Os11g41920.1 | downstream_gene_variant ; 3172.0bp to feature; MODIFIER | silent_mutation | Average:41.661; most accessible tissue: Callus, score: 76.689 | N | N | N | N |
| vg1125225529 | C -> T | LOC_Os11g41950.1 | downstream_gene_variant ; 4840.0bp to feature; MODIFIER | silent_mutation | Average:41.661; most accessible tissue: Callus, score: 76.689 | N | N | N | N |
| vg1125225529 | C -> T | LOC_Os11g41920-LOC_Os11g41940 | intergenic_region ; MODIFIER | silent_mutation | Average:41.661; most accessible tissue: Callus, score: 76.689 | N | N | N | N |
| vg1125225529 | C -> DEL | N | N | silent_mutation | Average:41.661; most accessible tissue: Callus, score: 76.689 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125225529 | 8.34E-09 | 4.93E-09 | mr1662 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125225529 | 7.85E-06 | 3.98E-07 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125225529 | 4.69E-06 | 9.49E-08 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125225529 | 2.22E-06 | 6.35E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |