Variant ID: vg1125184358 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 25184358 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 227. )
AGAGACACATAAAGGTACGATTCTATTTCAAATAGATCAATTTTACAGTATTTAAGATACTTATTACTTTGTGGTATCAAATTTATGAAATGCAGTATCT[C/T]
CTGGGTTTATTTTTTTCAAGGATAGTAAAATCACCCTTTCAAATAACCTCGCACACGCGTGAAATCAAACTAGTTTGCGCATAACGCCTATAATTCTTAG
CTAAGAATTATAGGCGTTATGCGCAAACTAGTTTGATTTCACGCGTGTGCGAGGTTATTTGAAAGGGTGATTTTACTATCCTTGAAAAAAATAAACCCAG[G/A]
AGATACTGCATTTCATAAATTTGATACCACAAAGTAATAAGTATCTTAAATACTGTAAAATTGATCTATTTGAAATAGAATCGTACCTTTATGTGTCTCT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 88.40% | 11.50% | 0.11% | 0.00% | NA |
All Indica | 2759 | 82.10% | 17.80% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 84.40% | 14.50% | 1.12% | 0.00% | NA |
Indica I | 595 | 69.60% | 30.30% | 0.17% | 0.00% | NA |
Indica II | 465 | 84.50% | 15.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 86.10% | 13.90% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 85.60% | 14.20% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1125184358 | C -> T | LOC_Os11g41880.1 | upstream_gene_variant ; 882.0bp to feature; MODIFIER | silent_mutation | Average:55.577; most accessible tissue: Zhenshan97 flower, score: 72.863 | N | N | N | N |
vg1125184358 | C -> T | LOC_Os11g41875.2 | upstream_gene_variant ; 4086.0bp to feature; MODIFIER | silent_mutation | Average:55.577; most accessible tissue: Zhenshan97 flower, score: 72.863 | N | N | N | N |
vg1125184358 | C -> T | LOC_Os11g41880-LOC_Os11g41890 | intergenic_region ; MODIFIER | silent_mutation | Average:55.577; most accessible tissue: Zhenshan97 flower, score: 72.863 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1125184358 | 1.89E-08 | NA | mr1238 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125184358 | 3.36E-07 | 2.31E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125184358 | 2.30E-06 | 2.43E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125184358 | 1.53E-06 | NA | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |