Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125184358:

Variant ID: vg1125184358 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25184358
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGACACATAAAGGTACGATTCTATTTCAAATAGATCAATTTTACAGTATTTAAGATACTTATTACTTTGTGGTATCAAATTTATGAAATGCAGTATCT[C/T]
CTGGGTTTATTTTTTTCAAGGATAGTAAAATCACCCTTTCAAATAACCTCGCACACGCGTGAAATCAAACTAGTTTGCGCATAACGCCTATAATTCTTAG

Reverse complement sequence

CTAAGAATTATAGGCGTTATGCGCAAACTAGTTTGATTTCACGCGTGTGCGAGGTTATTTGAAAGGGTGATTTTACTATCCTTGAAAAAAATAAACCCAG[G/A]
AGATACTGCATTTCATAAATTTGATACCACAAAGTAATAAGTATCTTAAATACTGTAAAATTGATCTATTTGAAATAGAATCGTACCTTTATGTGTCTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.40%	11.50%	0.11%	0.00%	NA
All Indica	2759	82.10%	17.80%	0.07%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	84.40%	14.50%	1.12%	0.00%	NA
Indica I	595	69.60%	30.30%	0.17%	0.00%	NA
Indica II	465	84.50%	15.50%	0.00%	0.00%	NA
Indica III	913	86.10%	13.90%	0.00%	0.00%	NA
Indica Intermediate	786	85.60%	14.20%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125184358	C -> T	LOC_Os11g41880.1	upstream_gene_variant ; 882.0bp to feature; MODIFIER	silent_mutation	Average:55.577; most accessible tissue: Zhenshan97 flower, score: 72.863	N	N	N	N
vg1125184358	C -> T	LOC_Os11g41875.2	upstream_gene_variant ; 4086.0bp to feature; MODIFIER	silent_mutation	Average:55.577; most accessible tissue: Zhenshan97 flower, score: 72.863	N	N	N	N
vg1125184358	C -> T	LOC_Os11g41880-LOC_Os11g41890	intergenic_region ; MODIFIER	silent_mutation	Average:55.577; most accessible tissue: Zhenshan97 flower, score: 72.863	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125184358	1.89E-08	NA	mr1238	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125184358	3.36E-07	2.31E-06	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125184358	2.30E-06	2.43E-06	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125184358	1.53E-06	NA	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251