Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125171325:

Variant ID: vg1125171325 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25171325
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.08, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTTTTTTTTACAAATTAAATTTAAAGCAATTTAACTTTAATTAAAGTTTAAATAACTTATAATCTGAAGAGTAATGGAAGGAGGGAGTAAATACGCAC[A/G]
CTGTCGCGTCGCACAGCATGTTGGTTGCTTGCTTGCTACTAGTAGCTGCCGCTCACTTTAGCCAATCGCACTCGCGCCTGAATTCCAGCGCCTCATCAAT

Reverse complement sequence

ATTGATGAGGCGCTGGAATTCAGGCGCGAGTGCGATTGGCTAAAGTGAGCGGCAGCTACTAGTAGCAAGCAAGCAACCAACATGCTGTGCGACGCGACAG[T/C]
GTGCGTATTTACTCCCTCCTTCCATTACTCTTCAGATTATAAGTTATTTAAACTTTAATTAAAGTTAAATTGCTTTAAATTTAATTTGTAAAAAAAAAGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.40%	25.20%	2.31%	35.10%	NA
All Indica	2759	19.60%	36.40%	1.78%	42.19%	NA
All Japonica	1512	66.80%	7.80%	0.86%	24.54%	NA
Aus	269	29.00%	17.80%	15.61%	37.55%	NA
Indica I	595	5.00%	29.60%	3.03%	62.35%	NA
Indica II	465	18.10%	42.20%	1.51%	38.28%	NA
Indica III	913	25.80%	34.40%	1.42%	38.34%	NA
Indica Intermediate	786	24.40%	40.50%	1.40%	33.72%	NA
Temperate Japonica	767	92.70%	1.20%	0.39%	5.74%	NA
Tropical Japonica	504	25.20%	16.30%	1.59%	56.94%	NA
Japonica Intermediate	241	71.40%	11.20%	0.83%	16.60%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	45.60%	23.30%	5.56%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125171325	A -> DEL	N	N	silent_mutation	Average:49.377; most accessible tissue: Callus, score: 98.666	N	N	N	N
vg1125171325	A -> G	LOC_Os11g41850.1	upstream_gene_variant ; 3579.0bp to feature; MODIFIER	silent_mutation	Average:49.377; most accessible tissue: Callus, score: 98.666	N	N	N	N
vg1125171325	A -> G	LOC_Os11g41860.1	upstream_gene_variant ; 394.0bp to feature; MODIFIER	silent_mutation	Average:49.377; most accessible tissue: Callus, score: 98.666	N	N	N	N
vg1125171325	A -> G	LOC_Os11g41860.2	upstream_gene_variant ; 373.0bp to feature; MODIFIER	silent_mutation	Average:49.377; most accessible tissue: Callus, score: 98.666	N	N	N	N
vg1125171325	A -> G	LOC_Os11g41870.1	downstream_gene_variant ; 3689.0bp to feature; MODIFIER	silent_mutation	Average:49.377; most accessible tissue: Callus, score: 98.666	N	N	N	N
vg1125171325	A -> G	LOC_Os11g41850-LOC_Os11g41860	intergenic_region ; MODIFIER	silent_mutation	Average:49.377; most accessible tissue: Callus, score: 98.666	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125171325	5.04E-07	2.50E-06	mr1134	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171325	7.02E-07	6.63E-06	mr1504	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171325	NA	5.44E-08	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171325	1.72E-06	NA	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125171325	5.54E-07	6.27E-08	mr1855_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251