Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125157024:

Variant ID: vg1125157024 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25157024
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGCATGTAAAATAGCAGAATATAAAACAGCTGTAAACATATATCGAGAAGATAAAAGACTAGATATATGAACAGTGGGCTACAGATTTATAGTCAGCT[G/A]
CAGCTAGCACGAACTACAAGATACAATGTGCGTATGATATGTGGAACCAAGTATCAATAATGCAGTATATATTTTTAGGTAACTATTGTATCTATGTGGA

Reverse complement sequence

TCCACATAGATACAATAGTTACCTAAAAATATATACTGCATTATTGATACTTGGTTCCACATATCATACGCACATTGTATCTTGTAGTTCGTGCTAGCTG[C/T]
AGCTGACTATAAATCTGTAGCCCACTGTTCATATATCTAGTCTTTTATCTTCTCGATATATGTTTACAGCTGTTTTATATTCTGCTATTTTACATGCTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	13.00%	0.02%	0.00%	NA
All Indica	2759	85.10%	14.90%	0.04%	0.00%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	47.60%	52.40%	0.00%	0.00%	NA
Indica I	595	94.30%	5.70%	0.00%	0.00%	NA
Indica II	465	84.90%	15.10%	0.00%	0.00%	NA
Indica III	913	80.20%	19.80%	0.00%	0.00%	NA
Indica Intermediate	786	84.00%	15.90%	0.13%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	96.30%	3.70%	0.00%	0.00%	NA
VI/Aromatic	96	57.30%	42.70%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125157024	G -> A	LOC_Os11g41820.1	upstream_gene_variant ; 3568.0bp to feature; MODIFIER	silent_mutation	Average:60.261; most accessible tissue: Callus, score: 84.407	N	N	N	N
vg1125157024	G -> A	LOC_Os11g41830.1	upstream_gene_variant ; 1502.0bp to feature; MODIFIER	silent_mutation	Average:60.261; most accessible tissue: Callus, score: 84.407	N	N	N	N
vg1125157024	G -> A	LOC_Os11g41820.2	upstream_gene_variant ; 3568.0bp to feature; MODIFIER	silent_mutation	Average:60.261; most accessible tissue: Callus, score: 84.407	N	N	N	N
vg1125157024	G -> A	LOC_Os11g41840.1	downstream_gene_variant ; 3001.0bp to feature; MODIFIER	silent_mutation	Average:60.261; most accessible tissue: Callus, score: 84.407	N	N	N	N
vg1125157024	G -> A	LOC_Os11g41830-LOC_Os11g41840	intergenic_region ; MODIFIER	silent_mutation	Average:60.261; most accessible tissue: Callus, score: 84.407	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125157024	9.78E-08	7.36E-09	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125157024	8.17E-06	1.50E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125157024	1.26E-07	1.40E-08	mr1238_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125157024	4.63E-07	3.12E-08	mr1484_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125157024	1.85E-09	2.22E-10	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125157024	NA	6.77E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125157024	9.60E-07	9.60E-07	mr1945_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251