Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125148067:

Variant ID: vg1125148067 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25148067
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCAGCATTAGAAATGTGCTTCAATATTTAGCCTAAGAACAAATTAAAGGTATGTTGCTAAGTATCTGTTGGTTTTAATGTACCGATTATAACCATGAA[C/T]
CCTGGAGCCACATGCGGGCAGGGTTTCCCAAACCGCCGGGGCCGGGGTTACCACGCCCCGGCGGTAAGCACGGTTACCGCGCGGTTACCGCGGTAACCGT

Reverse complement sequence

ACGGTTACCGCGGTAACCGCGCGGTAACCGTGCTTACCGCCGGGGCGTGGTAACCCCGGCCCCGGCGGTTTGGGAAACCCTGCCCGCATGTGGCTCCAGG[G/A]
TTCATGGTTATAATCGGTACATTAAAACCAACAGATACTTAGCAACATACCTTTAATTTGTTCTTAGGCTAAATATTGAAGCACATTTCTAATGCTGCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 44.50% 0.25% 0.00% NA
All Indica  2759 71.70% 28.00% 0.29% 0.00% NA
All Japonica  1512 31.60% 68.30% 0.13% 0.00% NA
Aus  269 41.60% 58.00% 0.37% 0.00% NA
Indica I  595 64.90% 34.30% 0.84% 0.00% NA
Indica II  465 58.70% 41.10% 0.22% 0.00% NA
Indica III  913 81.90% 18.10% 0.00% 0.00% NA
Indica Intermediate  786 72.80% 27.00% 0.25% 0.00% NA
Temperate Japonica  767 7.00% 92.80% 0.13% 0.00% NA
Tropical Japonica  504 70.60% 29.20% 0.20% 0.00% NA
Japonica Intermediate  241 28.20% 71.80% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125148067 C -> T LOC_Os11g41820.1 downstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:73.105; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg1125148067 C -> T LOC_Os11g41820.2 downstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:73.105; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg1125148067 C -> T LOC_Os11g41800-LOC_Os11g41820 intergenic_region ; MODIFIER silent_mutation Average:73.105; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125148067 C T -0.04 -0.04 -0.02 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125148067 2.60E-17 2.71E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 1.54E-14 8.29E-18 mr1191 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 2.62E-13 NA mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 1.80E-12 1.26E-14 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 5.21E-06 9.30E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 3.53E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 9.68E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 1.18E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 5.00E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 3.52E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 3.21E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 2.62E-18 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 7.39E-15 1.41E-22 mr1191_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 5.12E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 1.28E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 2.00E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 2.19E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 6.93E-08 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 1.70E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 1.95E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 1.02E-14 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 7.21E-21 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 2.74E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 6.73E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 1.56E-13 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 2.80E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 1.12E-09 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 7.77E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 3.32E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125148067 NA 1.60E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251