Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125117714:

Variant ID: vg1125117714 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25117714
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTCTATTTATTTTAAGGATTTGCAATGATTCATATTTGTCACCGTGGGTACCAGCACTATGTCCTGGGACTGGTACTGTGATCGCGGTTTCGTAGGAAG[C/T]
GGTTCACGCCGTTTTTCCTACGACACGCTCCTGTCAGGTGCCGTTGTACGAGCACAGCCGTCCCTGTCACGGAGGATATTACTAGGAGCCCGAGGGCTGG

Reverse complement sequence

CCAGCCCTCGGGCTCCTAGTAATATCCTCCGTGACAGGGACGGCTGTGCTCGTACAACGGCACCTGACAGGAGCGTGTCGTAGGAAAAACGGCGTGAACC[G/A]
CTTCCTACGAAACCGCGATCACAGTACCAGTCCCAGGACATAGTGCTGGTACCCACGGTGACAAATATGAATCATTGCAAATCCTTAAAATAAATAGAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 4.90% 0.08% 0.04% NA
All Indica  2759 99.70% 0.10% 0.11% 0.07% NA
All Japonica  1512 85.10% 14.90% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.00% 0.22% 0.43% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 99.60% 0.30% 0.13% 0.00% NA
Temperate Japonica  767 76.80% 23.20% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 88.00% 12.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125117714 C -> T LOC_Os11g41800.1 downstream_gene_variant ; 4221.0bp to feature; MODIFIER silent_mutation Average:41.875; most accessible tissue: Callus, score: 61.467 N N N N
vg1125117714 C -> T LOC_Os11g41800-LOC_Os11g41820 intergenic_region ; MODIFIER silent_mutation Average:41.875; most accessible tissue: Callus, score: 61.467 N N N N
vg1125117714 C -> DEL N N silent_mutation Average:41.875; most accessible tissue: Callus, score: 61.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125117714 2.78E-20 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 3.16E-12 3.02E-08 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 6.39E-14 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 2.31E-09 NA mr1300 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 2.23E-17 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 4.83E-13 1.54E-08 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.85E-14 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 4.75E-09 NA mr1310 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 3.20E-17 9.42E-21 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.07E-11 8.65E-09 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 2.36E-13 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.69E-10 4.10E-08 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.34E-15 3.35E-15 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 6.71E-14 1.49E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.51E-16 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 5.21E-10 NA mr1926 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 4.28E-07 2.68E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.86E-07 NA mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 6.77E-20 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.04E-14 4.30E-10 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 3.84E-10 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.29E-07 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 5.41E-22 8.72E-27 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 3.29E-11 3.29E-11 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 4.60E-11 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.36E-07 1.36E-07 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 7.53E-22 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 7.35E-17 3.89E-11 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 7.54E-17 1.21E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 9.63E-14 1.56E-09 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 4.80E-17 3.24E-21 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 2.73E-10 2.73E-10 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.65E-07 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714 1.23E-06 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251