Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125105649:

Variant ID: vg1125105649 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25105649
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTCTTTGTAGTAGGTTAACCCCACGCCTAATATTGGCAGCATATCCATCAGGAAACTTTAGTTCTTGAAACCATTTGAGAATTGTTGTTTTGTCAT[C/T]
CCTATCAATACAAAATGATGCCTCTGGTTTATGCCATTTTCCATTACCCTCTGACACTAATTGCAGTAATGGACGACTACAAATTTCAACCAAAACTTTC

Reverse complement sequence

GAAAGTTTTGGTTGAAATTTGTAGTCGTCCATTACTGCAATTAGTGTCAGAGGGTAATGGAAAATGGCATAAACCAGAGGCATCATTTTGTATTGATAGG[G/A]
ATGACAAAACAACAATTCTCAAATGGTTTCAAGAACTAAAGTTTCCTGATGGATATGCTGCCAATATTAGGCGTGGGGTTAACCTACTACAAAGAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.80% 18.80% 34.55% 5.86% NA
All Indica  2759 41.50% 2.30% 48.97% 7.18% NA
All Japonica  1512 38.60% 49.50% 7.01% 4.83% NA
Aus  269 52.40% 1.90% 44.24% 1.49% NA
Indica I  595 36.00% 1.50% 56.97% 5.55% NA
Indica II  465 33.80% 3.70% 50.32% 12.26% NA
Indica III  913 53.50% 0.80% 40.64% 5.15% NA
Indica Intermediate  786 36.50% 3.90% 51.78% 7.76% NA
Temperate Japonica  767 33.80% 62.20% 3.00% 1.04% NA
Tropical Japonica  504 42.30% 36.10% 10.91% 10.71% NA
Japonica Intermediate  241 46.50% 37.30% 11.62% 4.56% NA
VI/Aromatic  96 28.10% 47.90% 23.96% 0.00% NA
Intermediate  90 34.40% 25.60% 37.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125105649 C -> T LOC_Os11g41780.1 missense_variant ; p.Asp594Asn; MODERATE nonsynonymous_codon ; D594N Average:12.819; most accessible tissue: Minghui63 flag leaf, score: 17.021 benign 0.173 TOLERATED 1.00
vg1125105649 C -> DEL LOC_Os11g41780.1 N frameshift_variant Average:12.819; most accessible tissue: Minghui63 flag leaf, score: 17.021 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125105649 7.47E-16 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 8.71E-13 3.66E-14 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 5.97E-10 5.94E-25 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 NA 6.10E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 5.50E-15 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 1.60E-15 3.48E-14 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 4.97E-09 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 1.25E-17 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 7.03E-15 1.53E-15 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 6.18E-08 6.88E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 1.89E-06 1.89E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 3.43E-06 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 1.73E-14 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 1.53E-13 4.13E-14 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 6.34E-13 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 1.89E-16 1.92E-18 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 3.74E-09 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 5.72E-06 5.72E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 6.38E-09 7.74E-13 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 5.34E-07 5.71E-08 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 9.09E-14 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 2.59E-11 1.21E-11 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 9.54E-08 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 6.06E-14 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 7.76E-11 7.76E-11 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 7.21E-08 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 2.72E-09 2.72E-09 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 NA 1.23E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 NA 6.34E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 5.58E-16 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 1.22E-12 1.43E-12 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 3.07E-10 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 4.18E-10 4.72E-11 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 2.13E-11 NA mr1945_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125105649 1.97E-09 1.97E-09 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251