Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125087670:

Variant ID: vg1125087670 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25087670
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTTAAAATGGACATGGATACTTGTGTGATGTATATTGTCAAATTGCTTCATGTGTAGTTGTTTGTTGAGATGTATTTGATTTAAAATACAAAGTTGTT[G/T]
TATCATGTGCATCTTGAGATGTATTTGATTTTTCTTCATTTCGTACATTTGGGCTGAGGCATTTCTTTTTTTTTGGGTGATTTTTGATATCTGTGACGGG

Reverse complement sequence

CCCGTCACAGATATCAAAAATCACCCAAAAAAAAAGAAATGCCTCAGCCCAAATGTACGAAATGAAGAAAAATCAAATACATCTCAAGATGCACATGATA[C/A]
AACAACTTTGTATTTTAAATCAAATACATCTCAACAAACAACTACACATGAAGCAATTTGACAATATACATCACACAAGTATCCATGTCCATTTTAACAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	3.80%	0.42%	4.30%	NA
All Indica	2759	99.30%	0.10%	0.47%	0.11%	NA
All Japonica	1512	75.10%	11.60%	0.33%	12.90%	NA
Aus	269	98.90%	0.00%	0.37%	0.74%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.10%	0.33%	0.11%	NA
Indica Intermediate	786	98.50%	0.00%	1.27%	0.25%	NA
Temperate Japonica	767	73.50%	5.00%	0.65%	20.86%	NA
Tropical Japonica	504	75.00%	23.20%	0.00%	1.79%	NA
Japonica Intermediate	241	80.50%	8.70%	0.00%	10.79%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	93.30%	3.30%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125087670	G -> T	LOC_Os11g41760-LOC_Os11g41770	intergenic_region ; MODIFIER	silent_mutation	Average:27.571; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg1125087670	G -> DEL	N	N	silent_mutation	Average:27.571; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125087670	9.68E-06	2.53E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670	NA	7.38E-06	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670	3.36E-07	NA	mr1925	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670	NA	8.72E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670	3.81E-07	7.08E-08	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670	3.58E-07	3.58E-07	mr1484_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670	NA	7.79E-06	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125087670	2.89E-06	2.89E-06	mr1945_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251