Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125078873:

Variant ID: vg1125078873 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25078873
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, T: 0.11, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGCCTATTCTTCCTTCCAATTTGCAAGCAGTACAAAGGCTTTCATCCCTGTCTAGTTGCATGCATGTAACTAACTGCATATATGTGGCCATGGAAATA[G/T]
GTGGCATCCGGGCAAGAGCGATTAGGTGCAAACAGAGCCAGGTTACAGCTGATTCTCCCTCCAAGGATTGGTAAATTAGTATGTGCTCATCTCTGCTCTT

Reverse complement sequence

AAGAGCAGAGATGAGCACATACTAATTTACCAATCCTTGGAGGGAGAATCAGCTGTAACCTGGCTCTGTTTGCACCTAATCGCTCTTGCCCGGATGCCAC[C/A]
TATTTCCATGGCCACATATATGCAGTTAGTTACATGCATGCAACTAGACAGGGATGAAAGCCTTTGTACTGCTTGCAAATTGGAAGGAAGAATAGGCACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	8.30%	4.70%	12.08%	NA
All Indica	2759	65.20%	10.80%	6.42%	17.58%	NA
All Japonica	1512	97.50%	0.40%	0.53%	1.59%	NA
Aus	269	47.60%	21.20%	12.64%	18.59%	NA
Indica I	595	60.80%	15.30%	4.37%	19.50%	NA
Indica II	465	72.90%	7.30%	1.72%	18.06%	NA
Indica III	913	59.10%	9.60%	12.16%	19.06%	NA
Indica Intermediate	786	71.00%	10.80%	4.07%	14.12%	NA
Temperate Japonica	767	97.30%	0.30%	0.39%	2.09%	NA
Tropical Japonica	504	99.40%	0.20%	0.40%	0.00%	NA
Japonica Intermediate	241	94.20%	1.20%	1.24%	3.32%	NA
VI/Aromatic	96	75.00%	22.90%	0.00%	2.08%	NA
Intermediate	90	75.60%	10.00%	3.33%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125078873	G -> T	LOC_Os11g41760.1	upstream_gene_variant ; 1847.0bp to feature; MODIFIER	silent_mutation	Average:72.267; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg1125078873	G -> T	LOC_Os11g41760-LOC_Os11g41770	intergenic_region ; MODIFIER	silent_mutation	Average:72.267; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N
vg1125078873	G -> DEL	N	N	silent_mutation	Average:72.267; most accessible tissue: Zhenshan97 young leaf, score: 83.199	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125078873	7.88E-07	3.79E-19	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125078873	2.92E-06	6.35E-12	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125078873	1.60E-09	9.34E-23	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125078873	2.38E-08	5.12E-15	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125078873	2.84E-09	2.93E-33	mr1191_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125078873	5.29E-08	3.10E-21	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251